Thursday, 31 December 2015

etiquette - Is it okay to address "Prof. X" as "Mr. X"?


I am from the Netherlands.


I have seen quite a few threads which address the question of whether or not it is acceptable to address a professor by their first name. However, none of them seem to address the point of whether it is still permissible to refer to them as Mr/Mrs X?


For example, if you know that someone's full title is "Prof. Dr. X" is it acceptable to write them an email starting with "Dear Mr/Mrs X"?




reading - Advice and tools for hosting an online journal club


I have some experience with hosting reading groups/journals clubs in an off-line setting. Usually we meet every week in a room and discuss the paper for that week. However, recently some colleagues and I (~7 people) are trying to catch up on a specific topic quickly, and we want to hold a short reading group/journal club. Unfortunately, some of my colleagues are at other universities, and cannot physically attend meetings.


Do you have any advice or suggestions for tools to hold an online reading group?


My first instinct was G+ Hangout (especially with the new beta features they are making available right now). Skype is also an option, but last I checked required a fee for group video chat.


The preferred features are:



  • Talk to (and preferably see) each other


  • Have access to some sort of shared whiteboard

  • Easy to use and set up




biophysics - How non-invasive blood glucose concentration measurement work?


Diabetes patients need to conduct the “fingerstick” a few times a day. One of the mechanisms of "fingerstick" is to take small amount of blood sample and put it onto a test strip. The enzyme on the test strip reduces the glucose and the electronics of the glucose meter detect the redox species produced. However, this method is painful and increase the risk of infection.


Photonic sensing technology opens up a new method for non-invasive blood glucose concentration. According to an article of medGadget in 2013 (The link follows http://www.medgadget.com/2013/10/non-invasive-measurement-of-blood-glucose-levels-using-glucotrack-interview.html ), the non-invasive kind was invented. By simply clipping onto the earlobe (without puncturing the skin), the blood glucose concentration could be measured. Does anybody knows the working principle for that? Or, suggest a paper describing that?





interpersonal issues - How to cope with lab noise?


I have searched a lot and I am surprised that this topic hasn't been discussed yet. I am an M.Sc. Student in Computer Science. Our lab is actually a dry lab in which we need to do a lot of reading of heavy maths on a daily basis.


The problem is that some people (mostly senior students such as PhD candidates) sometimes speak loudly to discuss their new papers with lab mates, etc., which is totally a must-do activity but disrupts my mind and obviously some others that are not involved in their discussion.


I have tried many ways such as music, white noise, natural sound, etc., but all of them had drawbacks that forced me to abandon them. I even think of studying in the library sometimes, but I think it is not a good idea because it may make me isolated and also it may cause people to think that I am not working as expected. I also don't like the idea of speaking with the Prof. about this, because: first, the prof himself doesn't pay attention to speak low in the lab and I think this would be strange to him and second, I am so new and it may harm me.



What I want to know is: is this situation actually normal? And if not, how can I cope with that?



Answer




Is this situation actually normal?



Yup, pretty normal. It's what is called "office life".


I am almost tempted to vote to close this as a boat programming question, as it is really no different to any other "we-are-in-a-shared-office-but-my-office-mates-annoy-me" situation in any job. Anyway, I think this is common enough in academia that it may make sense to answer here.


Essentially, there are really only three ways to fix this:



  • Change the office layout. Either get smaller offices (very unlikely to be possible), or re-arrange the PhD student seating so that the quiet workers share offices as well as the enthusiastic discussers. Of course, if you have one big lab for all students, this solution is probably a no-starter (not common here in Europe, but I have learned that this is common in the US).


  • Home office. Probably the easiest, most immediate, and most common solution to the problem of the annoying other students is to spend more time working from home or another suitable location, especially if some high-concentration tasks are in the queue. Of course this requires a modicum of trust that PhD students that are not in the lab are actually still working, and not sleeping or using their XBox. Given your concern that you may appear as "not working enough" when you are not in the lab, this may indeed be a problem.

  • Noise cancellation. When we had this problem in our lab, the easiest fix was to buy a set of high-quality noise cancellation headphones from Bose. The ones we bought are massive enough that even just wearing them alone without any music already blocks out a lot of the regular room acoustics, and they are high-quality enough that you can wear them for hours without pain. Students that want to work now wear their noise cancellation gear, which incidentally also is a good "Do not disturb unless important" sign for other people that just want to chat.


I should mention that "talk to the other students and make them stop" isn't really a practical and permanent solution. There are just too many people with too many differing characters for too many hours a day in a typical PhD student office - if somebody is the chatty type, she or he will chat.


Btw., I feel for you. My productivity when I am alone in my office is twice of what it is when we are two persons, which is again twice of what it is when we are three. I was never in an office with more than three persons, but I presume I wouldn't even need to bother coming in. This Dilbert comic strip is representing my feelings regarding the current trend of "open floor plan offices" pretty well.


peer review - What to do if a colleague is reviewing an unchanged paper that has been rejected before on my recommendation?


Around a year ago, I reviewed a paper for a journal. The originality of the paper was questionable, and content and presentation were severly lacking throughout. Consequently, both another reviewer and I recommended rejection and gave detailed explanations to which the associate editor agreed. The decision including the review reports were sent to the authors.


Now, a colleague of mine just told me of a review request from another journal. Briefly summarizing the content of the paper, I realized that this sounded quite familiar. Expressing my concerns to my colleague, we compared the authors and the papers, and realized that this was exactly the same paper that was reviewed and rejected earlier, nothing has been changed (apart fomr some journal style specific things).


How should we proceed?



Answer



If you were asked to re-review an "unchanged" manuscript there are a number of things you can do (e.g., Asked again to review a paper, when the authors don't wish to modify it). The issue is that this is not the case. You are no longer part of the review process.


The first thing you should do is STOP. The behavior you have engaged in so far has been completely unethical and a clear violation of every reviewer agreement I have ever seen.



  • Your colleague should never have told you about the paper under review.

  • You should not have mention that you reviewed a similar paper in the past.


  • Neither of you should have mentioned authors or the title.

  • The actual manuscripts should never have been shared and/or compared


To a lesser extent, it is not even clear why you still have your copy of the manuscript.


The Committee on Publication Ethics (COPE) provides Ethical Guidelines for Peer Reviewers which can be thought of as best practice. These include:




  • respect the confidentiality of peer review and not reveal any details of a manuscript or its review, during or after the peer-review process, beyond those that are released by the journal





  • not involve anyone else in the review of a manuscript, including junior researchers they are mentoring, without first obtaining permission from the journal; the names of any individuals who have helped them with the review should be included with the returned review so that they are associated with the manuscript in the journal’s records and can also receive due credit for their efforts.




  • keep all manuscript and review details confidential.




graduate admissions - Psychiatrist from whom I requested documentation doesn't believe in accommodations for adults with ADHD/"hyperkinetic disorder" taking meds


Update (October 24/25):




You were approved for 50% extended time, breaks, water in the testing room, separate room, pens for scratch work, and extra scratch paper



Update (October 12/13):



Please be advised, you have been registered for the exam, while we work on reviewing your accommodation request. If approved you will be testing with accommodations for the exam. Please wait for the email decision letter from our review department.





TL;DR - I'm planning to take the GRE Subject Test in Math on Saturday October 29, 2016 in Country A to boost my profile for PhD applications.





  • I have ADHD, which I discovered in August 2015.




  • I am planning to request reasonable accommodations for the GRE Subject Test in Math.




  • I have recently moved to Country A from Country B.




  • **ETS has advised me to submit documentation from both psychiatrists.





  • My Country B psychiatrist is amenable to writing me the disability documentation, but my Country A psychiatrist is not.**




  • I am unluckily the recipient of one of those doctors who (practically) doesn't believe ADHD exists




  • I am not likely going to get another psychiatrist in time to submit the required documentation (disability documentation takes 6 weeks to review; I am planning to submit on Saturday September 3, 2016).





  • How can I appeal to ETS for reasonable accommodations without disability documentation from my current psychiatrist?




Any advice on my dilemma would be highly appreciated.




Through this question which is of academic origin but somewhat medico-legal in nature, I hope that I may get advice.


I wanted to keep myself anonymous, but it looks like I will have to reveal aspects about myself in order to get advice.


My Background


I am a citizen of Country B and a permanent resident of Country A: I was born in Country A and lived in Country A for sometime until I moved to Country B (my parents are originally from Country B) for some time because we could not afford the cost of living in Country A. Eventually in 2013, we were able to afford the cost of living in Country A again and so we moved back to Country A. However I stayed in Country B to complete my master's degree which I finished this year (June 2016). I moved back to Country A last month (July 2016).



I was not treated for ADHD until last year: I was diagnosed by a psychologist in Country A in January 2000 but started treatment only in August 2015. I was not taking any classes at that time; I was in Country A having online consultations with a psychiatrist in Country B. At the same time I was under the care of a psychologist in Country A.


First time in school as an ADHD student: In January 2016, I went back to Country B to resume my masters studies and was under the care of a different Country B psychiatrist from January 2016 until July 2016 (6 months). At the same time, I was having online consultations with my Country A psychologist. This was my final semester as a masters student of mathematical finance and the first semester where I appealed for accommodations.


I was granted accommodations in my university: I submitted documentation from my Country B psychiatrist and my Country A psychologist to support my appeals for reasonable accommodations. My university doesn't have a disability office (I don't think any university in Country B has a disability office because it's third world). so while I was granted accommodations of using a timer while taking exams and taking an exam in a separate room, I was denied extra time. So I spoke to a lawyer and the head of the counselling office and appealed to the dean of student services and the dean of sciences which led me to be assessed by a third party psychiatrist (to substitute for not having a disability office) to qualify for extra time on examinations and projects. Specifically, I requested and was granted 1/3 extra time on exams.


My current dilemma:


I moved back to Country A in July 2016 and am living with my family. I have been under the care of a new psychiatrist in a public hospital and my original Country A psychologist.


The hospital in Country A where I am currently going for consultations does not treat ADHD (or "hyperkinetic disorder"*). I was told that they treated only "mild" mental disorders. So when I moved to Country A in July 2016, I was immediately referred to a different hospital. Unfortunately, I can't start having consultations until October, 2016.


Not having time to ask about the GRE in my last visit, I asked my current (Country A) psychiatrist just today if he would have problems writing me disability documentation. I explained to him my exam difficulties that led me to be assessed as qualifying for 1/3 extra time by the third party (Country B) psychiatrist, and showed the documentation from my own Country B psychiatrist, my Country A psychologist and the third party (Country B) psychiatrist. The Country A psychiatrist indicated he would have a problem writing me disability documentation. From what I remember, the opinion is that granting reasonable accommodations applies mainly to primary school/grade school students, not so much to secondary school/high school students and almost never to adults with ADHD. His view is that my difficulties are shared by normal people and that everyone gets distracted, anxious or has time management problems.


To be absolutely clear, it is not the case that my current (Country A) psychiatrist acknowledges the need for reasonable accommodations for people with ADHD and deems me as not qualifying for such.


Rather, my current (Country A) psychiatrist does not acknowledge the need for reasonable accommodations for people with ADHD.


I asked to be referred to a different psychiatrist and was told that I already had been. The most he could write for me was a note certifying my diagnosis.



I believe I do not have the time, money or probability:



  • to have an appointment with a private psychiatrist,

  • to be referred to a different psychiatrist in my current hospital,

  • to move up my appointment in my soon-to-be-new hospital,

  • to make successful complaints to my hospital or to the Hospital Authority of Country A

  • to file a legal case or

  • to be allowed to submit disability documentation from my (Country A) psychologist


If I was living in Country B, I would just submit the documentation from my Country B psychiatrist who saw me for 6 months and that would be it. Unfortunately, my discovery of the GRE Subject Test in Math was in June 2016, I moved from one country to another and I again unluckily was the recipient of one of those doctors. Technically, the Country A psychiatrist is not one of those doctors that doesn't believe in ADHD, but might as well be. I have to put up with this for about two more consultations.



Anyway, I have to submit the documentation soon (again, Saturday September 3, 2016). How can I appeal to ETS given my situation? The only thing that comes to mind is explain what I just explained and then ask for the possibility of the following:




  1. To submit documentation only from my Country B psychiatrist who saw me for 6 months (January 2016 - July 2016)




  2. To submit documentation from my Country B psychiatrist who saw me for 6 months (January 2016 - July 2016) and my Country A psychologist




Again, any advice on my dilemma would be highly appreciated.





*Psychiatrist follows ICD not DSM. I didn't mention DSM initially but BrianDHall brilliantly deduced its relevance.



Answer



I think the most important part of the ETS documentation page is their conclusion:



ETS is committed to providing equal access to our assessments for all test takers. If you have been diagnosed with ADHD and believe you need accommodations for equal access during the standardized testing process, ETS will evaluate, individually, the information that you provide and will work with you to identify any additional documents we require to make a timely determination of your eligibility for accommodations. Of the many thousands of applicants who request accommodations every year, over 80 percent ultimately receive accommodations.



In short: provide them with what you have, give a short, professional description of any material request that you cannot obtain, and hope for the best. Either they will accommodate you (as ETS reports they do for "over 80 percent" of people "ultimately"), or they won't and you will not have extra time on the test - which will not necessarily prevent you from doing acceptably on the exam, but obviously isn't ideal.


First, give it your best shot with what you have. Give them as much of the paperwork requested as you can, such as including paperwork from the professional from Country B. You will want to be honest but very concise. If they requested info from the second provider and they only agree to confirm your diagnosis but nothing else, you may want to basically say "the provider has stated that they do not personally believe in adult accommodations for anyone, and can only confirm the diagnosis" - which may violate at least American norms for standard of care, but is not so strange as to be unbelievable at all.


For those not familiar with this area of psychology, note that the ETS specifically mentions the DSM 5, which is a standard for mental health diagnosis in the US - but is not universally well regarded or used outside the US (though is not at all unheard of). The ETS and GRE are US based, but they should be familiar with the issues of how non-US providers may view things like ADD/ADHD and their lack of support for the DSM 5.



You can basically hope for the best, but "prepare for the worst". They may simply deny your request, or require more paperwork that will mean that you can't take the test during your required period of time.


As for preparing for the worst, if you are only requesting a 1/3rd extra time on the test, it is very possible that you can still do acceptably on the test as is. You should prepare for the test as best as you can and may have no choice but to give it the best go you can and do as well as you can in spite of the non-ideal circumstances. Some people require far more drastic accommodations, such as having a personal reader, assistive technology, even more extra time, etc. These people would have no chance of completing the test without accommodations, so I guess it could help to think "well, it could be a lot worse".


To build your comfort you can download timed example test software from the ETS website, and simulate normal test taking conditions in the place of your choosing, for free. It will even give you an estimated, unofficial score. You may find it helpful to go ahead and give it a try to see how you can do, and to improve your test preparation. You can also have the software simulate 1/3rd extra time on the second example test, to test just how big of a difference it could potentially make for you and if it would be worth the extensive work and expense to try to delay taking the test and getting some kind of paperwork to get accommodations.


I wish you the best regardless, and I hope this can help you even a little.


Wednesday, 30 December 2015

genetics - Why do we use DNA sequencing methods such as shotgun?


I am learning about DNA cloning for the first time. What I understand is that, in order to clone DNA, we break-up the original gene into shreds. Then try to piece it back together.


Why exactly do we do this? Instead wouldn't it be better to clone one base at a time? Basically in pseudo code:



old_dna_strand = 'ACTCATGCGAGCGTCAGTAGTACGTACTG'
new_dna = ""
for base in old_dna_strand:
new_dna+=base

That looks a lot more easier and a lot less prone to errors. Why do we have weird methods such as shotgun?


Thanks in advance. Let me know if i should clarify or update anything in this question.



Answer



This is a technique from the "old time" of genome sequencing. The underlying method for sequencing is the Sanger chain termination method which can have read lenghts between 100 and 1000 basepairs (depending on the instruments used). This means you have to break down longer DNA molecules, clone and subsequently sequence them. There are two methods possible.


The first is called chromosome (or primer) walking and starts with sequencing the first piece. The next piece of DNA (which is and then uses a specific primer from the end of the sequence. The next (contigous) piece of the sequence is then sequenced using a primer which is complementary to the end of the first sequence read and so on. This technique doesn't require much assembling, but you need a lot of primers and it is relatively slow.



To overcome this problem the shotgun sequencing method was developed. Here the DNA is broken into different pieces (not all broken at the same place), cloned and sequenced with primers specific for the vector used for cloning. The leads to overlapping sequences which then have to be assembled into one sequence on the computer. This method allows the parallelization of the sequencing (you can prepare a lot of sequencing reactions at the same time and run them) which makes the process much faster and also avoids the need for sequence specific primers. The problems are to sequence repetitive sequences, as overlaps are not as clear here. To resolve this problems a first draft is made and then critical regions are resequenced using other techniques as primer walking. Have a look at the Wikipedia page about shotgun sequencing if you want to read more details.


human biology - How do bile salts affect lipase activity?


BACKGROUND: It is well known that bile salts are needed for emulsification of fats. It is then said that this increases the surface area for activity of pancreatic lipase, implying that bile salts make pancreatic lipase more effective. But it is also said that pancreatic lipase do need a colipase to overcome the inhibitory effect from bile salts.




QUESTION: So what does bile salts actually do? Do they increase or decrease lipase activity? How does colipase overcome it?





MY ATTEMPT: After some research , I found that bile salts above critical micelle concentration have inhibitory effect, but could not still comprehend how does the colipase makes lipase more efficient. Also if greater concentration is inhibitory then why does our body just secrete it in sufficient amounts? Isn't it be more efficient than to make a whole protein(colipase)?



Answer



Let us first clear out some basic concepts regarding lipase, colipase and bile salts. The pancreatic lipase has an optimum pH range of about pH 8.0 (Worthington). This can be understood easily by Le Chatelier's principle: as the reaction moves forward, there is reduction of pH (due to formation of fatty acids). So, a basic pH would help the reaction in moving forward. See this diagram (Worthington):


lipase reaction


It can also be understood on the basis of lipase's optimum pH, which lies between pH 8-9. See the graph (orange line) (Chegg):


graph pH


This optimum pH is brought about by bile salts. Bile salts are slightly alkaline, with pH range of about 7-8 (Britannica). This helps lipase in catalysing its reaction. Bile salts also help lipase by increasing the surface area of fat droplets. Bile molecules have a hydrophobic and hydrophilic part. The hydrophobic part is attracted towards fat while the hydrophilic part is attracted towards water. This helps stabilize fat droplets by emulsification i.e. breaking the fat droplet(s) into smaller parts. This also increases the surface area of fat droplets.


Now, the matter gets complicated when we talk about concentration. Since bile molecules contain hydrophilic and hydrophobic ends, they tend to form micelles with increasing concentration (just like soap). As long as its concentration is below critical micelle concentration, it will carry on emulsification and increase lipase activity. But when its concentration becomes more than the critical micelle concentration, it will form micelles and not carry on emulsion. This significantly reduces lipase activity by not only decreasing surface area, but also reducing pH to slightly acidic (Erlanson et al, 1973). This is where colipase helps. Colipase binds to the C-terminal, non-catalytic domain of lipase and stabilizes its active conformation and increases the hydrophobicity binding site (Verger et al, 1999). Colipase strongly binds to the ester bond of the triglyceride molecule, by which its hydrolysis by lipase becomes easy (Mansbach, 2011). Thus, colipase helps in overcoming the inhibitory effect or bile salts on lipase.


graduate admissions - Prospective PhD contacts potential supervisor but receives no answer after 2-3 emails, what to do?


Say a prospective PhD has a high reply rate (90-95%) to first contact emails with potential superviors. He/She has a well thought out e-mail, but a particular professor (here: USA) that is in the top preferences does not reply after two to three e-mails that were sent within a time frame of three months. I also followed the instructions on the professor personal website in the section "prospective PhD students". The student has already contacted some of the advisor students and has received positive feedback about the professor.


Should the student just give up and move on? Should the student keep trying?


Aside from the obvious "I have too many incoming e-mails to answer" or "I am out in the field", what could create a no response behavior from the professor?


I have seen the simplistic answer "move on, bad advisor, doesn't have time, etc". But this seems a contradiction in this case. The PhD students like the professor and say he/she is personable and no e-mail response after a few well written emails.



Answer



I am going to assume we're talking about a student who plans to apply to the PhD program that the faculty is affiliated with, but has not yet been admitted. (You didn't say explicitly, but reading between the lines, that is my assumption.)



If that's the case then the student should not expect a response and should not read anything into the lack of a response from the faculty member. Many faculty do not have time to respond personally to all enquiries from prospective applicants.


Please understand that some faculty receive dozens or hundreds of enquiries from prospective students. For example, my understanding is that many Indian or Chinese students are under the mistaken impression that they should contact faculty, or think it will help their case for admission somehow (not true; but they don't know, or have been given bad advice, so they write). Anyway, as a result, many faculty cannot possibly reply to all such contacts. I've even seen a few faculty post a FAQ on their web page which explains why they cannot respond to such inquiries from prospective PhD students who are interested in applying. In many cases, it is likely that few or none of those who contact the professor will be admitted, so professors may understandable decide that they cannot afford to to spend time responding to such contacts until after admission, in most cases.


To learn more about this, I can recommend some additional reading:




  • Advice for Prospective Research Students - a FAQ one professor posts, about how to contact professors




  • Writing to me - Advice from Female Science Professor (a pseudonymous professor/blogger) about how prospective grad students should write to her.





  • In general, anything from FSP is worth reading. Here are some additional posts of her that are relevant, and that may help to understand the professor's mindset:







If I have misunderstood the status of this student:


If the student has already been admitted into the PhD program where the faculty is affiliated with, but has not yet accepted the offer of admission, the lack of response probably indicates lack of interest or lack of time on the part of the faculty member. In this case, my advice would be to move on. As far as I can tell, though, this response would be a bit unusual: if the student has been admitted, it typically means that at least some quorum of faculty think highly of the student.


Finally, if the student is current enrolled in the faculty's PhD program, the student should go visit the faculty member in person. Faculty have office hours; go use them.


evolution - Hill-Roberston effects and effective population size


From this article, first page, middle of the second column:



Even if harmful alleles do not become fixed, they can still reduce the efficacy of selection on neighbouring loci through a process called Hill–Robertson interference. This effect occurs because individuals bearing deleterious mutations are less likely to survive and reproduce, reducing the number of individuals that contribute genetically to the future population. This reduces the effective population size witnessed by a focal locus



I don't understand the link between the Hill-Robertson effects and the effective population size. Why would the effective population size be greater in absence of Hill-Robertson effects? Can you please make this link clear to me?





Here is another question on the same article.



Answer



Hopefully this syllogism will answer your question.


Given the following premises:



  1. In the absence of selection, fitness of individuals are at a theoretical maximum.

  2. If a theoretical maximum fitness is achieved then effective population size is maximum.

  3. If there is an allele that confers both increased and decreased fitness you have a genetic conflict (e.g. an allele that turns you green gives you good woodland camouflage but is un-attractive).

  4. If a deleterious allele is linked to a beneficial allele this is similar to having a genetic conflict.



The conclusion follows:


Strong linkage between beneficial alleles and deleterious alleles (Hill Robertson effects, i.e. 3. and 4.) prevents a theoretically maximum fitness to be attained (1.) and thus a reduced effective population size (2.). Which can only be overcome by high levels of recombination and mating (i.e. by separating deleterious and beneficial alleles).


Tuesday, 29 December 2015

graduate admissions - How can I improve my research experience for PhD application?


It's well-known that many grad schools (especially top-ranked) require some research experience from prospective students and consider this as main criterion for accept/reject decision.


During undergraduate study I was working on my research (hadn't finished it - had solved just one particular case) - but can't say it was great research. Now I work as software developer in subdivision of national Academy of Science. My position requires only coding, no problem solving (there's no projects here requiring any fundamential research).


How can I make any research (better related to my field of interests) without being undergrad or MS student, without working in lab. Can I simply choose interesting problem (e.g. my undegrad problem), work hard to solve it and then refer to that in research statement? Who should write letter of recommendation in this case? Or I must have any advisor (who can verify my results and then write recommendation letter for me)? Can it be unofficial advisor (just researcher I know well)?




etiquette - How to deal with an inappropriate greeting in an email?


I'm relatively new to teaching (I was just hired as a tenure-track English professor at a local community college and have been teaching for just about 2 years). I recently received an email from a male student (he is in his mid-50's), and he addressed me as follows:



A great morning to you my dear lass,



Now, the email was complimentary. He thanked me for teaching a great course and said that he learned a lot in my class (all of these things are nice to hear). He has, at times, been difficult to teach (he questions academic conventions regarding basic essay structure, such as not beginning or ending a body paragraph with a quote), but he eventually concedes and makes the necessary adjustments (I am teaching a developmental writing course).


Usually.


I was just a little surprised by his choice of greeting. I am not overly familiar with my students, and I am not young (I am a divorced, 40-year-old woman). I like this student, and I am unsure of how to address this (or if I even should...) situation without causing offense. I feel certain he didn't mean to sound condescending and sexist, but... I also feel certain that if I was a 40-year-old male professor he would not have began his email with "A great morning to you my dear lad."


I would really appreciate any advice concerning how to address this issue. Additionally, I am teaching a combo course, and we just completed the first half, so he will continue to be my student for another 8 weeks.




Answer



Personally, I would address it in a friendly way, but one that makes it clear that you think it's a bit of an odd form of greeting. It doesn't sound like it was intended in an unfriendly or disrespectful way (and I definitely wouldn't characterise it as sexist), but it does sound inappropriately overfamiliar (it would be a bit like one of my students starting an email to me with "Dude! ...").


The easiest way to deal with it, to my mind, is just to send a fairly normal-sounding (but obviously more formal) email back, and mention it in passing in a friendly way at the end. For example:



Dear ,


Many thanks for your email - really glad to hear that you've been learning a lot from the course. It's been good to see the improvements in your essay structure since the start of the course - I'm hoping that you'll be able to solidify those improvements over the next 8 weeks.


Kind regards,



p.s. Just a friendly piece of advice - whilst I'm not generally too fussy about people addressing me formally, I think I should probably steer you away from things like "my dear lass", not least because some people if addressed that way might take it the wrong way and get offended. I'm fine with people calling me by my first name (if the OP actually is), but I think that's stretching things too far.




credentials - I have a degree but it isn't actually what it looks like it is. How do I list it on my CV?



Due to various department sortings and organizations, I have a degree that is, functionally, a computer science degree but because it belonged to the College of Mathematics, the degree is formally "Mathematics".


Unfortunately this leads to many employers thinking that I have a mathematics background when the reality is far from this: I don't think like a mathematician or particularly enjoy its work.


Is there something I can do with my CV to reduce this bias? Is it as simple as changing "Mathematics" to "Computer science" even if it isn't the official title of the degree? Are there other options?




Is a second PhD ever necessary?



I'm an undergraduate student. I used to think that a PhD certifies a person as an expert in a specific topic of a specific field. I've now been told that while that's true, a PhD most importantly proves that you are capable of independent research in general.


A professor of fluid dynamics told me that if he wanted to shift his research to an unrelated topic like dog anatomy, rather than getting a second degree he would seek out successive projects that get progressively closer to his research interest (e.g. a project on modelling blood flow in a dog, etc.), until eventually he is working on his originally unrelated research interest.


Is the above approach generally valid? If it works, then what legitimate reason is there to get a second PhD?



Answer



I would tend to agree with your professor: a Ph.D. primarily certifies you as being capably of creative contribution to research, and secondarily as an expert in a narrow sub-discipline. Combine that with the continually shifting landscape of the scientific frontier, are there is a great deal of flexibility in what a person with a Ph.D. may end up doing over time.


I have heard one of my close colleagues say that: "One way or another, in ten years time we can't be doing the same thing we are now. Either we will have succeeded and need to move forward, or we will have failed and need to try something else."



In such changes, there is usually a significant degree of continuity that allows one to "pivot" from one area for another. Like in your professor's example, there are a lot of ways in which dog anatomy and fluid dynamics are related, and it's natural that an expert in fluid dynamics might well be drawn to the parts of anatomy most relevant to their existing skill.


A nice real-world example of such a radical transition: Tom Knight made his name pioneering networks and computer architectures, then radically shifted into biology. There is a nice interview with him about his history and how he made the transition, which involved lots of re-education but not bothering with the formality of another Ph.D. He's also moved back and forth between industry and academia quite a bit.


That said, I could imagine some transition so extreme that it might require an entirely new apprenticeship, e.g., from astrophysics to medieval French history. But that sort of change would be a rather extreme an unusual example.


Postdoc Funding for an American looking to do a postdoc in europe (in Theoretical Computer Science)


Hi I am doing a phd in theoretical computer science, and will be finishing this year and applying to postdocs for Fall 2016. I am an American, but for various reasons would like to study in Europe. Ideally the professors I am interested in would have postdoc funding available, but since that is often not the case, are there any grants/fellowships that cover postdoc salaries available for americans studying in europe? Are there other funding options I'm missing? Am I correct to assume that in europe like in America one gets postdoc funding from the professor (or from a grant), not from the department as a whole? As you can see, I know little about how funding works in Europe!



In case the answer to my question is country specific, the countries that I am most strongly considering so far are Germany and Switzerland.


Thanks for your help!




Monday, 28 December 2015

botany - Evolution theory - roses spikes - being more bulgy doesn't give you advantage


I've seen spike, huge spike. And I thought that development of such spikes could be contrary to the evolution theory.


Spikes


Being „little more” spiky doesn’t give you any advantage... So those individuals having one won't have smaller mortality rate than those with smooth stem. Even more, the individuals with bulgy (more spiky) waste resources their ruggedness and have more things to feed, which should mean that they would have higher mortality rate.



So I can see no way to develop spikes on the stems of roses according to the evolution theory which embrace "small improvement". Spike is only efficient (to deter aggressor) when it's very sharp, it's either sharp or it isn't - there is little in between.


Could anybody tell me that this is bullshit (and why it is bullshit), and that I should us believe in Darwin competence?;)




Should I respond to editors about unprofessional review?


I think I am in a very similar situation to this question, with the exception that my submission has been refused. I do not want to start a flame, but to me, one of the two reviewers didn't took the necessary time to do a proper review.


The first reviewer made a thorough summary of the paper, and explained in an extremely clear way what were his/her doubts and which parts were not strong enough. The second one looked like a baby plugging his hears and screaming "It stinks! It stinks!". He only attempted to make a point that resulted to be wrong since he was substantially criticizing how an algorithm works (Random Forests), even though it's empirically demonstrated to be effective.


Now, based on the constructive critiques of the first reviewer I refined the manuscript and attempting to submit to another journal. What I can't stand is the behaviour of the second reviewer.


Generally speaking, is the idea to respond to the editor about the bad (where bad is like in the linked question) review(er) a viable action, or should I just ignore all of this and go on?



Answer



Frustrating as it is, this is something that happens to many authors at some point, and the simplest solution is to shrug and move on. The editor probably already knows that the review is sub-par, and has decided to move on anyway. Arguing with the editor at this point is not just attacking the reviewer, it's attacking the editor's professional knowledge and judgement. It's not impossible to have a good outcome from responding, but it's unlikely. Even if you do get a positive response, the editor would simply send it out to a new set of reviewers, so even the best-case scenario has you starting all over anyway. Find a new journal and send it there.



That's assuming that the review is genuinely completely useless. From your description, I'm not convinced. The reviewer may be wrong, but it doesn't sound as if their process is completely wrong; there is a specific reason for the rejection, it is based on something in your paper, and the fact that there is empirical support doesn't seem like a strong argument in your favor. Before you resubmit to another journal, you should seriously consider how to deal with that issue.


peer review - Should a paper be reviewed in entirety, if the introduction contains plagiarized passages?


I'm very new to being a peer reviewer. I agreed to anonymously review a paper for publication, and while reading it for the first time, I was a little annoyed by the writing style. It sort of reminded me of the feeling I get when reading a paper from a student in an undergraduate Liberal Arts Math course. When I began to read it again, I was very uneasy about the writing, especially in the introduction. There were inconsistencies in style. Some short, dry sentences followed by longer passages using flowery language. I looked at the references and noticed a few secondary sources. One was a NY Times article. I looked up the article online and in the first paragraph found a passage that was almost identical to one in the introduction section of the paper I'm supposed to review. I was shocked. And then I found more.


So far, all of the plagiarism that I've found is in the introduction. I haven't read the rest of the paper carefully yet because I'm fairly disgusted.


My question is this: should I even bother writing a review? If this were an undergraduate paper, the student would get an F on the assignment and get reported to the Dean. I want to write to the journal editor and just tell him that the paper doesn't deserve to be reviewed.



Has anyone seen this before, and what did you do? If you decided to review a paper like this, how would you phrase your feedback?



Answer



See the Council of Science Editors white paper on publication ethics at:


http://www.councilscienceeditors.org/resource-library/editorial-policies/white-paper-on-publication-ethics/


and the Committee on Publication Ethics flow charts at


http://publicationethics.org/resources/flowcharts


Many journals follow these recommendations or similar ones in handling ethical issues.


As a reviewer, your job is to report this to the editor. The editor should take it from there.


I'm actually somewhat surprised that this paper even made it to the review stage- most publishers now routinely check all submitted papers for obvious plagiarism using tools that check against large databases of published papers and other material. Normally, this would have caught the kind of plagiarism you've described.


mathematics - Math preparedness for an Econ PhD


I am currently getting my masters in Public Policy and considering getting a PhD in the near future. I'm looking for advice on whether to pursue a PhD in public policy or economics. I've heard that public policy phds are not as well received as econ phds on the job market. My fear with applying to the econ phd program is that I have not taken the advanced course work in linear algebra, matrix theory, real analysis and the other standard econ prerequisites. I will say though that a majority of my courses in my masters program have been quantitatively focused, having passed the equivalent of calc I and II, but my concern is that they are not in depth enough to make me a competitive candidate for admission.


Would something like coursera or MIT open courseware math courses in these subjects be sufficient? or should I take something for credit at a local college?


Appreciate the advice!




evolution - Why does so much variation exist within species?


My last phrasing of this question did not go down well, so I will try again.


The genotype of species is not always the same. If you ask yourself why not all of these possible expressions except one have died out, a natural answer is each genotype occupies a specific niche: For example, different eye colors might be found attractive by different kinds of people. If the the genotype for one eye color became more rare for some reason, other individuals with this genotype had a higher mating chance; the frequency of that genotype would get pushed back up.


But there seem to be genotypes (for example, having zits) that don't occupy any niche at all. Why didn't they die out?




publications - how useful are solo papers?


I have heard a few times that having single-author papers is good for your career. I suppose this is because it shows you are capable of producing research on your own. But I wonder if it is a double-edged sword. Say you are early in your career and have only solo papers. Does this also look bad because it suggests you are not good at collaborating?




evolution - Have creatures ever evolved to become less intelligent?


Inspired by https://worldbuilding.stackexchange.com/questions/58533/is-intelligence-the-natural-product-of-evolution , I'm wondering if creatures have ever become less intelligent as a result of natural selection and evolution.


It seems plausible, because the brain can use a lot of energy, and I've heard of other aspects of an animal atrophying because they're not useful any more, such as vision in the Mexican blind cavefish.



One possible candidate I can think of is the koala: it's described as having a low brain to body mass ratio, doesn't have a great need for intelligence, and may have a need to minimise energy usage.


I'm mainly interested in cases of natural selection, as opposed to artificial breeding - I wouldn't be surprised if we selected animals to be less intelligent.




health issues - How to deal with anxiety and depression after being kicked out of PhD program?


I was kicked out of a programming-oriented PhD program at the end of last summer because I failed one of two qualifying exams; the department is keeping me on assistantship for a semester while I finish a master's thesis (which I've done).


Now over the past few months, I have developed a strong depression and even feel suicidal. I feel that I've been given many great opportunities and squandered them. Applying to jobs in my field didn’t work out either due to lack of interest from the prospective employer or the employer getting a negative impression from my interview.


I've had many jobs throughout my life, and without exception I have struggled and usually failed due to extreme anxiety. Honestly, I don't even know if I would want a job even if I was offered one, because I feel that I would waste the employer's time and cause myself greater suffering, and ultimately fail.



How can I deal with these issues?


EDIT: Thank you all for your kind advice and support; for any of those interested, I'm on a more even keel now than I was when I wrote this question, and I have taken steps toward mental recuperation.


I should also say that I won't be checking in on this question anymore, so any further comments are unlikely to reach me.


Thanks.



Answer



Seek clinical help! The fact that you are here means that you are someone who believes that you need the help of others and that is very respectable. The problem is that this community, with all the good people in it, is not a good place to provide the help that you can actually benefit from.


In your question, there are a few points that are important. Suicidal thoughts are always serious and must be considered seriously. Failure is not easy to bear and nobody can say that they can have a good time failing their goals but normally, people do not think of self-termination when they fail. If you are having this thought, please seek help.


Also, you mentioned that you have failed multiple times in your life before. If the number of these failures is a lot, maybe you are suffering from some underlying problem that is inflicting your performance. Conditions like anxiety (as you mentioned), depression, ADHD, ... can have a drastic negative impact on performance and the sad fact is that in many cases, people who suffer are not aware of it. If this is the case for you, look at the bright side of your situation which is the potential of finding the root cause, elimination of which can improve your life dramatically. Again this is something that can only be confirmed with the help of clinical professionals. Please seek help.


Remember that failure is hard but also remember that even Einstein failed to procure an academic position many times so it happens and it happens to everyone. As Churchill once said:




Success is the ability to go from failure to failure without losing your enthusiasm.



Give it some time and move on. That is the most important part.


I repeat myself; please consider the fact that self-termination thoughts should be considered very seriously. Based on your country of residence, conditions may differ but nevertheless, accept the fact that, in any country, there exist people who are trained to provide the type of the help that you can benefit from. Please find them.


publications - How to suggest reviewers for a journal?


I recently tried submitting a paper to a journal. It was mandatory to suggest three reviewers. Is this a norm in journal submissions? If yes, how should one choose reviewers if I do not personally know any experts in the field? I have been submitting papers to conferences and never found such conditions there.



Answer



Being editor of a journal where authors can provide preferred and non-preferred reviewers, I can provide some "inside" thoughts on the subject based on what has happened in "my" journal. Note that it is possible to suggest names for review but also provide names which are not preferred. The latter can be because of a scientific disagreement, personal issues or whatever. Such suggestions appear but not often and we usually follow the suggestions (not that we have to!).


When it comes to the preferred or suggested reviewers, I have been tempted to use such reviewers on occasion when it has been hard to identify reviewers directly. Sometimes because the topic is local and where it would make sense to have local input. In these cases, I cannot remember a single reasonable review that has come out of such reviewers. This can be for several reasons but most often the review is a close colleague who might have an incentive to help the author. In some cases the preferred names have been very senior scientists who, I am afraid, has lost touch with the subject and provide poor and in some cases almost non-existent reviews. Out of all immediate "Accept" review recommendations I get, the vast majority have come from these reviewers. So, I not longer trust these names and avoid them at all costs unless I personally know or know of the reviewer and his or her good reputation.


In addition to what I just describe, I also must state that it is often the weakest manuscripts that have listed several suggestions. This can be identified by the disparate review results, sometimes one accept (by the suggested reviewer) and one reject.


Now, in principle, there is nothing wrong with suggesting reviewers, I have done so myself when being requested. I have then as a principle gone for established and well renowned names in the community. The problem lies in suggesting names for a purpose other than to get a fair and objective review.



It is clear that the system can and is abused and since I became Editor-in-Chief, I have come to rely less and less on these suggestions and now mostly look upon them with suspicion and make selections from my own understanding of the field and investigations into the subject literature. The best suggestion, I can provide is to not avoid mentioning names but pick names that in your opinion can provide good constructive critique on your work (and not just favorable). A note on why you have selected names as preferred or non-preferred would greatly help as well since it puts your choice in a perspective.


Sunday, 27 December 2015

publications - Will I destroy my career if I published a paper with a serious mistake?


I'm an undergrad and kind of new to this whole research thing. I've been doing research for the past ~9 months as a requirement to graduate with my bachelor's (there's the research track and software development track, I chose research).


I was told to try and submit my paper to conferences/journals (depends on their deadlines) to see if it gets accepted. But, one thing my professor said really stressed me out. If my paper gets accepted, and people find a serious mistake in it (ones that could cause your conclusion to be wrong, etc), it would destroy my whole career before it even began.


Can anyone with more experience go into detail about what could really happen? Assume, that the paper really gets accepted. On one hand, I'm not entirely confident of myself, and on the other, I have found a passion in research and would love to continue on for a PhD in future and this might help boost my resume a little given it is my only research experience.



Answer



Congrats on your paper. No, it wouldn't destroy your career but it would be awkward and embarrassing. It could potentially hurt your career if the mistake was the result of obvious sloppiness, gross incompetence, and worst of all, outright dishonesty. But for the first two of those, the damage would very likely be containable and if you keep doing research, after publishing another paper or two that had no mistakes, no one would remember this minor incident.


With that said, your advisor is correct that it's best to avoid publishing papers with mistakes in them if at all possible, so do make a sincere effort to check everything to the best of your abilities before submitting the paper.


Saturday, 26 December 2015

species identification - What is this bizarre insect?


Well, a friend of mine sent me this picture of an creepy insect. I'm wondering if the picture is photoshoped or if it is real. It is said the insect lives in Indonesia, but I'm not sure.


enter image description here



Can anyone identify this? Thanks.



Answer



This is a Creatonotos gangis


This nice arctiine moth was described by Linnaeus in 1763. The species lives in South East Asia and parts of Australia.


C. gangis went viral earlier this year because of a post in The independent where they wrote about a facebook video on the species... I don't know if this is the same video that was popular at facebook, but take a look:


https://www.youtube.com/watch?v=hn1ms8qfqzM


Furthermore, I can tell you that those weird tentacles are in fact scent organs which secrete pheromones in order to attract sexual mates. And also, their larvae cause huge problems because they eat pomegranade leaves


publications - How to withdraw your paper from an open access journal where it has been accepted?


My paper got accepted in a mediocre open access journal. However later I found out that its publishing fees was too high.


What would be the correct way of asking a withdrawal of your article from the journal?




Answer



If it has been accepted but you have not yet signed any sort of agreement, then it's easy in theory: you just tell the editor that you have decided to withdraw the paper. They might be unhappy, but you have a right to do this (both legally and according to academic norms).


If the paper has already been published, then there may not be anything you can do. Retracting a published paper is serious business, done only in cases of serious error or unethical behavior.


If you have already agreed to some sort of license allowing publication and paid (or agreed to pay) but the paper has not yet been published, then you should move fast. Legally the journal can go ahead and publish, and they may decide to do so, but your chances of convincing them before they publish the paper are higher than after they publish it.


There have been stories of unethical journals publishing papers that have been withdrawn and then demanding money. If that happens, then it is serious misbehavior on the part of the journal (and proves you were wise to withdraw the paper).


Friday, 25 December 2015

career path - What can I do as a graduate student to maximize my chances of obtaining a professorship?


I've already completed my first grueling year of the PhD program, and graduation is still a yet to be seen light at the end of the tunnel. I'm very sure that academia is for me, and I really want to obtain a tenure-track position in my field (computational science). I know that universities often look very highly upon doing a post-doc and accumulating plenty of journal publications. Of course, open faculty positions are extremely competitive and I'm sure that everyone applying for them have those qualifications already. I'm curious if there is anything else I do as a graduate student to help maximize my chances of getting a Tenure-Track Faculty position in the future?



Answer




I don't think there's anything "special" that's unique to applying to academia that a graduate student can do to increase the odds of becoming a professor in the long run, particularly if one is going to do a postdoc later on.


The two areas that might help are:




  1. Gain teaching experience that goes beyond the standard "recitation section" leader—that is, into actual lecturing and other forms of direct interaction with students, as well as formulation of assignments and examinations. This might make a difference at schools which are more teaching-oriented rather than research-oriented.




  2. Formulate a well-defined scope for your future research activities, and also develop the tentative outlines for the first few projects that you'd start in that field. This is an essential part of any professorial application, and the sooner you start working on it, the more polished it will be when you're ready to apply for positions when the time comes.





Beyond that, what makes someone a good candidate for a postdoc are essentially the same qualities that will help in being a good candidate for a professorship later on.


undergraduate - Will a self-designed major lower my chance of acceptance for graduate school?


I am in the process of designing a major. However, I am worried that using a self-designed major can make an application look bad. As it stands, this potential major is about 70% computer science classes, 30% psychology and neuroscience classes. As such, this leads me to the questions:




  • Are these self-designed majors seen as "weird" or simply unacceptable?

  • In general, are self-designed majors unattractive for graduate admissions?

  • For computer science specifically, do majors matter?




evolution - Cat's tail movement as an indicative of tension


It appears to me that tail's twitching in the cats indicates how much tension the individual is under. During a hunt, when a cat tries to stay invisible, while approaching a target it is almost immovable, yet the tip of the tail keeps on moving restlessly.


Is there an explanation for such a behavior? How does it help?




Thursday, 24 December 2015

graduate admissions - Letter of Recommendation Expiration Date


I have 9 and 10 months old recommendation letters. Can I use these when applying to graduate programs (United States)? Is that okay with the admissions committee?



Answer




In addition to other points already made, in most situations you do not send the letters yourself, but have the recommenders send the letters directly. Sometimes this involves simply uploading the letters to a web site, but this would be done _by_the_recommenders_, not by you.


Thus, some action will be required by your recommenders.


phd - Are there rules dictating that a Ph.D. supervisor must have a Ph.D.?


Is there any specific rule that requires someone supervising and awarding a Ph.D. to have a Ph.D. themselves? I learned recently in some parts of Asia it is possible to have a Masters degree and award a Ph.D. One point made was, in the example of Korea, there was no education system and as such it was required for this to be the case at some point. This seems to have continued. Does this exist in United States or Europe as well?



Answer



No, there isn't any general rule.


First, a PhD degree is awarded by a university, not by an individual.


The education system of a country or the university rules usually define which positions can officially act as supervisors. The same education system or the university rules establish which titles should have a person to be eligible for those positions: if the PhD is not required, which is not uncommon, there can certainly be PhD supervisors without a PhD.


Another case is the following: in Italy the PhD degree has been established some thirty-odd years ago. This means that most of those who became professors in Italy before that time don't have a PhD (as Federico rightly observes, some might have taken it abroad), but they surely can supervise students officially.


ethics - Is it ethical to use past years' final exams that the professor hasn't explicitly given, to study for a final in the same class?


This happened to me in my 2nd year of grad school, in a STEM field. As many do, our professor gave the class the last year's final, to give us an idea of what areas to study and what to expect, etc, which he obviously isn't required to do and is very nice of him.


Now, the reason he gives us last year's one is because, at the end of the year, he returns your test, so he knows that most of the ones floating around are the ones from last year.


However, as many older professors (in my experience, but maybe younger ones too) do, he also reuses exams from previous years (not even concepts or the same problems with different parameters, just literal copies), since the material and curriculum of this course is very well established/so old that nothing needs to change. I don't blame him for this; if you teach the same course on and off over 20 years, coming up with good exam questions over and over again would be annoying.


Now, what my question regards is, I realized a student in my class had past tests from not just the last time the class was taught, but literally the past 5 years. I don't know how to say this part as diplomatically as possible, but this student came from a country that about nearly half our program comes from. The other half (aside a few outliers) is from the U.S. I don't mention this to demonize or stereotype anyone; I believe it's relevant because the students from this country (in my program) are almost uniformly very tight knit, and seem to often share resources between each other and across years more than is normal amongst everyone else. The relevance is that one group has resources that others don't.



So my question is, is this ethical (for the student to do, I mean) ?


Just to put some relevant ideas/arguments/details down:



  • Assume (and I believe it was the case) that in the scenario I've written, the rest of the students (the ones who don't have the past tests) don't know about the students that have the past tests, so they can't do something simple like ask them.

  • I think many will argue that if the professor didn't want this happening, he wouldn't reuse tests, or at least as exactly as he does. However, I don't think this changes the ethics of the situation: the point is, in this situation, you can get away with it, but is it right?

  • I imagine the professor would not approve of this (actually, recently, another professor said in regards to his final "I know there are past ones floating around, please don't look at them", so at least he disapproved), but an argument could also be made for the possibility of him approving: It's not as though having the previous tests just makes it a given that you'll ace it, it's still a lot of work to figure out all the problems such that you can reliably do them later (he doesn't give back the answers to the tests, only the tests themselves). I could imagine a professor being okay with students getting a better grade on the final if it meant they learned more and worked to get it.

  • This professor never actually said not to, so the student wasn't explicitly disobeying anyone.

  • This question really has two subquestions, but they're very similar: a) Would it be ethical if everyone had these pasts tests (that the professor did not know about/give)? And b), Is it ethical if only a subset of the class has these tests. Obviously if you say no to (a) you say no to (b), but you might feel as though the concept of using past tests isn't wrong, but some students having an unfair advantage is.




Wednesday, 23 December 2015

ethics - Moral dilemma in unwittingly being paid to complete a student's work


I am a computer science freelancer who takes on medium-sized projects I can complete in a month or less. I was approached by someone who wanted a set of 12 tutorials at least 500 words each about certain programming topics with code examples and workouts. We talked payment and I accepted this project and got to work. I have been using GitHub to write the pieces and publish them privately on my account.


Here's where things get tricky. After I had completed the tutorials, but before I sent them to him, he disclosed to me his full name and the institution that he attends. It turns out that this was his honors project for an undergraduate major in Computer Science. He has already paid me.



My dilemma is this: I would like to return his money and not send him the tutorials and have him fail his school project. However, I have worked on this for 3 weeks, and I obviously need the money.


In our original conversation, he made no such mentions of secrecy, so at the very least I could make the GitHub repository public and still accept his payment.


My question is this: What is my best course of action? I don't want him to submit that work as his own. However, I still would like to get paid as he did not confine to me he was planning on plagiarism until the very end.



Answer



I think you should take the money, try to retain as much of my copyrights as possible (the law may help you do this implicitly rather than explicitly, which may be helpful), and refrain from doing anything else until after the student misuses your work.


Why? Consider that:



  • Plagiarism is not a crime.

  • Copyright violation is a crime.

  • Neither has occurred yet.


  • You have done the work in good faith.

  • You are not responsible for preventing others from plagiarizing your work.


Refunding him and keeping the work would be unfair to you because you have already done the work. You have every right to keep the money for the work you have done.


Refunding him and keeping the work would be unfair to him too, since he has every right to obtain the work from you that he has paid you for and waited for. Even if you refund his money, you can't refund the time that he has spent waiting for you to do the work, so you would arguably be liable for damages too.


If your work is actually plagiarized, then you will have a basis for complaining academically and/or legally, and it will be more difficult for your client to view you as a "snitch", etc. if he violates your copyright.


If you let his institution know before the deed occurs, then I'd argue you're doing something morally wrong: you're getting him into trouble for an act that he has not even committed yet. (This might be fine for dangerous actions, but this isn't one.)




Clarification:


I should clarify that my answer is only intended for a "generic" freelancer, not someone who has something else at stake too. For example, if you yourself were e.g. a professor/graduate student/public figure/etc., then you could earn yourself a bad reputation among your colleagues by giving him the work even if most other people would consider what you do to be entirely ethical/moral/righteous. In that case, the wisest career move for you may not be the same thing as what a typical freelancer might or should do, so keep in mind I'm not addressing such situations.



How are GPAs from different universities evaluated for admissions to MS programs in the USA?


I am about to apply for a Master program in U.S. as I am about to graduate in Bachelor of Engineering. Though I heard that all my grades during all my academic life is taken into consideration (GPA). Here in Brazil is very common to have a huge gap between universities both in teaching level and avaliation process. So, holding a degree from a weak college may be much easier and thus helping you to get a higher GPA while a well-known college will be much more difficult and probably your grades will be lower. Even though you have a degree from the very best college and you do have a good knowledge of most subjects, the GPA from the person who came from the weak college may be higher.


This also extends to the outside world (comparison between GPA's from different countries). So, how is it really done in practice? Do I still hold a reasonable chance of getting into a nice college with not a so high GPA?



Answer



We have the same phenomenon in America, of course. All other things being equal, a 3.5 GPA from Princeton is much more impressive than a 4.0 from some random state university. The whole idea of GRE scores is to provide a metric that isn't confounded by the difficulty of different programs at different colleges in these ways. An additional difficulty you face is that your American evaluators won't know how good or bad your university is. This makes your GRE score doubly important.


Recombinant protein fraction in E. coli


If a protein is heterologously expressed in E. coli under the T7 promoter, what fraction of the total protein concentration in the cell is the heterologously expressed protein? What could be its concentration at most? Does it strongly depend on the size of the protein or are there certain size thresholds for low/high expression?




Tuesday, 22 December 2015

etiquette - Proper "notice period" for resigning a tenure track position?


My apologies in advance if this is a duplicate. I did search a bit about this before posting here.


This is related to my previous posts so, briefly: I want to leave my current position and I have another offer that I will eventually accept (not finished negotiating). I won't be able to "officially" drop the hammer for at least 1-2 weeks (negotiating, getting the offer, signing it, etc.). I teach one absolutely essential course in the fall (a core course in a graduate program) and no one else is qualified to teach it but me.


My question: In a tenure track position, what is the minimal notice period for leaving? This is not a question about "what my department would like" or how to optimize my standing with the department after leaving. This is a question about professionalism-- specifically what is the minimal notice period where the department members couldn't justifiably go around calling my conduct unprofessional. (I couldn't create a "professionalism" tag, so I tagged this with "etiquette")


Clearly, leaving one week before the semester is too late. Giving 2 years notice is probably more than enough. The answer must be somewhere in between. In my own case, I am contemplating delivering the news in around two weeks (so, over three months before classes begin).


Edit: (1) This is related to a previous question I asked


I want to leave my tenure track position before fall. I have great prospects but no new position "locked up": when should I break the news?


But I think it is still distinct. That question raised the issue of whether to inform my department before having a definite offer, in the interest of giving them enough time to plan. This question is about the standards of professionalism in resignation notice (analogous to the conventional two weeks in many non-academic jobs).


(2) Our contracts are year-to-year (August through April) with guaranteed renewal before tenure review. There are no specific terms written there about resignation periods. I could just fail to renew my contract (this issue would arise in about two months) but, still, the question is whether this is meets the standards of professionalism in academia, not whether it's "legal".



Answer




Hiring an adjunct or borrowing someone from another department for one course is about the least bad thing that can happen in this world. Giving the kind of notice (9 months?) that would have allowed them to do a full candidate search is impossible for folks who move laterally out of a department. This is pretty common and departments simply have to manage it. Everyone knows that offers are being locked in during the April-May time frame, and sometimes you lose someone key. It would not be unprofessional if you chose to avoid delaying your career by staying for an extra semester in order to make your current department's process painless.


Nobody wants to see you go, but you're working within the system to the best of your abilities. You're not screwing them, and it's not unprofessional to wait to give notice until the new offer is accepted.


citations - Reference manager with note-taking/quote-storing capabilities


I'm looking for a reference manager with note-taking/quote-storing capabilities. I don't need a full knowledge management suite, but I want to find a program where I can store and search long notes/lots of quotes, attached to entries in my bibliography.


So far I've used:




  • Bib(La)TeX + pen and paper

  • Zotero

  • Mendeley

  • Paperpile

  • (Not sure about Endnote, but at least I haven't seen it used for what I need.)


Pen and paper obviously isn't searchable, and funnily enough, neither are the notes in Zotero. All of these programs treat notes as negligible, focusing on PDF metadata import and annotations, PubMed or Google Scholar search and whatnot. Which is all fine but not what I'm looking for. Since I work in the Arts & Humanities I still have my fair share of books accompanying the PDF articles in my work routine. For those I don't need any online specialties but rather a way to attach lots of quotes, notes, summaries and so on.


From what I've heard, Citavi can do some things like that, but I'm nowhere near a Windows computer to try it out. Ideally I'm looking for Linux programs, I could try Mac, and give bonus points for a web interface.




mathematics - Career prospects for a Math PhD student in pure math?


I have scoured the internet and everyone seems to be saying different things. These range from




  • "You will have no problem getting a job in quant/finance etc", to

  • "You are in a hopeless situation and are completely unemployable"


Consider the following situation:



  • I am at a PhD student at a mid-20s US institution studying pure math

  • I have very limited programming skills

  • I am an Australian national and want to live in Australia long term.



I am not overly optimistic about my future career prospects. Since I am near the beginning I thought I better think about this now rather than 5-6 years down the track.


Question: Is it likely that I'll be able to find a reasonably well-paid, stable job after graduation (even outside of academia)? Are there things I can do now to improve my chances (beyond "trying hard")? Would I be better off doing another masters in computer science or machine learning back in Australia instead of this PhD in pure math?




Monday, 21 December 2015

species identification - Which organism built this 2 cm long sandy tube?


I found this tube and wondered which animal built it.


It is 2 cm long and has an entrance/exit hole on one side. The material seems to be sandy.


I assume it is for breeding purposes.



Before finding the tube, I saw an unfamiliar kind of wasp around (could also be a hornet), with very long black legs. However, I could not find a wasp or hornet that builds such tubes, so it could be unrelated.


Location is Germany.


My questions are: which organism built this structure and should I expect anything crawling out one day? Or is it unfinished, since the entrance isn't closed?


Tube from above


Tube entrance



Answer



This is the nest of a Mud dauber, also known as Mud wasp. This was possibly made by a Black and Yellow Mud dauber based on the following information.



The nest of the black and yellow mud dauber is a simple, one-cell, urn-shaped nest. 1*





As for expecting something coming out of it? I doubt it, as the nests are sealed after depositing an egg.



After building a cell of the nest, the female wasp captures several spiders. The captured prey are stung and paralyzed before being placed in the nest (usually 6-15 per cell), and then a single egg is deposited on the prey within each cell. The wasp then seals the cell with a thick mud plug. 2*


Eventually, the hatching larva will eat the prey and emerge from the nest.



graduate admissions - Is it ok for one of your letters of recommendation to come from someone in the department/program to which you are applying?


[See title.] It seems ok, but one might consider it unfair in some sense? I just wanted to make sure this is acceptable. (I am specifically talking about graduate school applications.)




Edit: I apologize for previously withholding some information. Here are some more details.



  • I am majoring in math and will have two letters from math professors at my undergrad institution.

  • I also have a letter from a professor in a different department ("probability/statistics") in the same institution and am applying to this department's graduate program.




Effect of bland cover letter for journal submission in biology


I'm not used to writing covering letters for journal submissions, and I believe this is pretty standard in maths. However, I got into a conversation with a friend in biology, who said they expect to write about a page explaining why the paper is so great.


To me this seems an unhelpful practice: a paper should be judged by the quality of the paper, not by the quality of some other document.


We came round to the question:



How would an editor of a biology journal react to a paper submitted with a covering letter that amounted to 'here it is'?




Answer




All journals I have come across their guide for authors require a cover letter. Although it's probably partially a remnant of older times, where letters and manuscripts were mailed to the journals, it does have functionality.


The cover letter is a quick way for the editor to decide if it's even worth opening the full article. For this reason, arguments on the novelty, findings, importance, challenges and perspectives of the work should be demonstrated. In practice, it might not be much different than the abstract (different structure of course), but some journals also ask for specific questions to be answered.


It also helps the editor, who might not have the same expertise as the manuscript, to decide whether it's worth sending the manuscript to external reviewers. It also saves him a few hours of work from reading the whole article to understand its value.


It also adds a degree of personal communication between the corresponding author and the editor, rather than being a automated, impersonal submission process.


Finally, I usually add sentences like "all authors have agreed to submit the manuscript in this journal" or "no conflict of interest" etc, which adds a signature under the statements.


In the case a cover letter would only say "here it is", I think the editor would probably drop it in the trash bin, unless:



  1. The title (and the abstract) conveys a subject so important that any editor could not bear not to check it out more thoroughly.

  2. The corresponding author, or one of the co-authors, is a really big name in the field, that (even if the article is not that important) the editor cannot just reject it.



So, in mathematics, maybe just saying "Here is the solution of the problem X" and everyone knows the problem and die to see the solution, then you don't need to add much. But in sciences where a problem doesn't have a name, a more detailed explanation might be required.


Lastly, the manuscript is indeed evaluated by the manuscript itself. However, a good cover letter might make the editor check your submission more thoroughly, out of the tens or hundreds of manuscripts they may receive.


I think of it as the trailer to a movie. If you like Batman and you see Batman on the title, you will check the movie a little more before deciding if it's a crap movie or not. If you see a movie is directed by let's say Spielberg (and you like him), you may do the same. But if you are unsure about the title and you don't know the actors and directors, a trailer might convince you to watch the movie.


ethics - Is it ethical to give (paid) private tutorials for a student in a module I am TA'ing?


My TAing mostly involves helping students working on their programming assignments during classes.


A student asked me to give him private, paid, tutorials for the module, being concerned that all 'usual' resources to which he has access for free (book, classes, a bit of time outside of classes with me) won't be enough to cover his starting gap in this course.


Is this ethical? In particular, is it ethical from the point of view of other students in the course? They might think he is getting a privileged treatment, if he doesn't tell them I am being paid for that time. Should I ask him to notify them? Worse, they could think I am giving out solutions to him (I won't, but they might not think that's the case).


Should I speak with the professor of the course myself about this? Or could I ask the student to discuss his difficulties with the professor first, and eventually ask the professor himself if I can private-tutoring him?



Answer




Should I speak with the professor of the course myself about this?




I'd recommend telling the student you can't do it, and mentioning to the professor that you were asked but turned it down (to avoid any rumors). There are massive issues here:




  1. Being paid extra compromises your ability to grade the student's work. It looks too much like a bribe, and the fact that the student will presumably stop paying you if the tutoring is ineffective (as measured by grades) creates an ongoing incentive to grade leniently or supply inappropriate degrees of help. Even if you feel you can avoid bias, the apparent conflict of interest is so strong that other students will almost certainly be upset. Think about it this way. If the extra money doesn't matter to you and you have enough time, why not help the student for free? The fact that money is changing hands at all indicates that the money matters to you (as it would for most people), and that is evidence of dangerous incentives.




  2. It could look like you are extorting money from your students. This is the flip side of the first point: in addition to your incentive to offer too much to those who pay extra, you now have an incentive to offer too little to those who don't hire you as a tutor. Some students always grumble about how unhelpful their TA is (regardless of the facts), and you really don't want them speculating that your supposed unhelpfulness is intended to pressure them into paying for extra tutoring.





  3. I'd bet this is a major violation of university rules. Of course you'd have to look into your own case, but I'd be shocked if any university allowed course staff to accept paid tutoring from their students.




I'd be wary of asking the professor whether this is acceptable. For most questions, asking can't hurt, but here the ethically questionable aspects are so strong that asking whether it is OK could look bad. If you ask, you should be sure to make your understanding of the ethical issues clear, to avoid giving the impression that you think it's fine and just want to check whether the professor has any objections.


If the student needs a tutor, I'd recommend pointing him towards official university channels. For example, perhaps your department maintains a list of students who would be willing to offer tutoring. The important thing is to avoid any appearance of conflicts of interest. Recommending hiring your friend instead of you is better than accepting the job yourself, but it could still look awkward. (Students might wonder whether you were receiving a commission or kickback from your friend, or whether securing jobs for friends was enough of an incentive to influence your behavior.)


phd - Waiting time for editor's decision


I resubmitted a manuscript to a journal (listed in political science as well as in International Relations and Economics journal rankings). The editor's decision was minor revisions. The email says that after resubmitting, the final decision will be made by the editor's team asap (asap=as soon as possible). My re-submission was more than 6 weeks ago.
I was wondering how long I should wait until I approach the editor and ask about the decision without being rude and impatient?
My question is also spurred by the fact that I am PhD student who writes a cumulative dissertation and thereby, accepted (or even published) manuscripts are important ;)

Any experiences, advices or recommendations are very welcome!



Answer



After six weeks you can probably ask, but don't ask repeatedly. Just explain that the paper is important to you as a component of your dissertation. You don't need a long explanation or a plea for exceptional treatment.



Depending on the journal, six weeks may be an instant in time. But it is long enough that it is reasonable to ask. If they are overly busy, however, your question may take a while to answer.


citations - Almost everything we know is taken from someone else, so what do I cite in a paper?


My professor commented that I should have cited more on my paper. I received 132 out of 140 points on the paper for the error. I'm studying history, so being a learned subject, isn't everything we know about it taken from someone else? How would I cite everything I have ever learned over the years dealing with history through conversations/ TV/ internet/ from childhood? I didn't know when I was a child that I needed to remember who told me that Rome was a global power back in the 1st century :) How far do we go with this?