Sunday, 31 July 2016

How are letters of recommendation handled when they come from a member of the admissions committee?


I've asked three professors from the school I did my undergraduate studies at to write letters of recommendation for me. However, one of the schools I'm applying to is that same school.

In other words, lets say I went to Harvard as an undergraduate, asked three Harvard professors for letters, and then applied to Harvard's graduate program.


It seems kind of weird to me that my letter writers will review the letters they wrote for me as part of the committee review of my application. And I know at least two of them are for sure on the committee, the third I'm not sure about.


Undoubtedly, this is something that happens all the time, but I was curious how this situation is handled by the committee.


Of course, there are more committee members than the three who wrote recommendation letters for me who don't know me as a student as well, so it gives them a chance to learn about me.


I'm just wondering how this influences their decision, or, rather, how they can prevent it from influencing them too much. I know being accepted won't be a guaranteed thing, but how can you not accept someone that you yourself have recommended?



Answer



I've seen this situation. In our department all faculty vote on admission decisions (we don't have a separate committee that is delegated to make these decisions.) The faculty who have written recommendations have typically argued in favor of admitting the students they've written recommendation letters for, but it would also not be surprising if a faculty member who recommended a student felt that other candidates were better qualified when it came time to make final decisions.


It's one thing to say "I think student A is well qualified for our graduate program and a TA." This is not inconsistent with "After reviewing all of the candidates, I feel that students B and C (with BS degrees from elsewhere) are the most deserving of the two available TA slots." or even "After discussion with other faculty members, and reading all of the recommendation letters, I've agreed that student A should not be admitted to the program."


It's important to understand that these are group decisions, and that faculty committees often operate by discussion and consensus rather than by simple vote counting- a lot can happen during such a discussion.


As an applicant, there really isn't anything that you can do about this- the faculty in the department will deal with it as they choose.



Style of inline citations (numeric)



In the paper that I am writing using LaTeX, I have several sentences like:


However, in \cite{aa2014} only a small uncertainty has been introduced ...

Or,


According to \cite{ab2014}, ...

Because I am forced to using numerical references, the result is respectively:



However, in⁴ only a small uncertainty has been introduced ...


According to⁸, ...




I don't like this style of citations so I am looking for improvements. I have been able to rewrite some of the sentences so that I can put the citation at the end of the sentence, but this does not always seems to be a good idea. Are there better options?



Answer



I agree that sentences like



According to⁸



are horrible to read, although I recall seeing them a couple of times. A possible solution is to add author names:



According to Alice and Bob⁸



However, in Alice et al.⁴ only a small uncertainty has been introduced ...



mathematics - Applying for postdocs: mention two-body problem in cover letter?


My spouse and I are both finishing Ph.D's in math and applying for math postdocs in the US. We work in different areas of math, but there are many departments in which both are prominently represented. A postdoc position in the same place is not an absolute must but a big plus for us, and would likely be a deciding factor if choosing between offers.


My question: would adding a statement in the cover letter to the effect of "My spouse xxx is also applying for this position" be helpful, or is it more likely to disqualify both of us in the eyes of departments? We have different last names, so someone who does not know us well personally would probably not know we are together.


The advice for tenure track applicants seems to be not to divulge such personal information until the interview, but there are no interviews for math postdocs so I'm not sure whether the advice would be different.




genetics - Is there a possibility that medicine will affect the efficiency of natural selection?


I mean, saving sick people means that they possibly can propagate something that nature does not allow. I know that there is already something that operate at genetical level producing alteration, i.e. genetical mutation. And i am well aware that natural selection and genetical mutations take place really slowly.


p.s. i really want medicine to work!!



Answer




Summary: Yes it can, but not the way you might think.


Humans aren't under a lot of selective pressure on a large scale right now. We have a lot of control over our environment, and you're accurate that disease (or I'd add massive, fatal natural disasters) are the biggest ways we would see a large genetic shift. (Or genocide, which is an extremely unnatural, artificial selection, but some of our species have historically been horrific enough to try to do this.)


Small local natural selection has happened in areas where Malaria is endemic: many people die from malaria. some people die early from homozygous sickle cell anemia, but those who are heterozygous have "sickle cell trait" (because of incomplete dominance) and have deformed enough RBC that malaria isn't able to infect them well. So the survival advantage is enough that the prevalence of sickle cell alleles in these areas is higher. There's a similar story with Glucose-6-phosphate dehydrogenase deficiency.


But on a scale you might be thinking of, the primary mechanism would be a global pandemic infection that targets people with a specific trait. For example, if suddenly an incurable contagious, virulent, highly pathogenic, and fatal virus/bacteria that was only fatal to those with an allele for blood type A were to emerge. Theoretically it would cause a genetic shift to eliminate type A blood from the gene pool, and reduce prevalence of type B (by eliminating AB due to the A). Or if it attacked only one location of the world, but that's highly unlikely due to global travel.


Medicine could theoretically catch it in time - mitigate impact and prevent a large shift by creating a vaccine or cure that is effective and easily mass-produced. The most likely to succeed would be a vaccine (yay for public health!).


Variations on this have happened to reduce or eliminate pathogens (such as polio and smallpox because of the vaccine) and their effect on mankind, but those have little to do with selection for human traits that would cause genetic shift.


evolution - Why don't mosquitoes evolve towards muting themselves?


Quite certainly, muted mosquitoes would be much more effective as far as their blood-sucking pursuits are concerned, since mosquito sound is predominantly responsible for sealing their fate (between the two palms of the hand). Muting themselves would certainly reduce the chances of being caught in the act. For instance, unless you notice by looking, leeches go undetected for long periods because there isn't any obvious sound emanating from them.


Thus, reasoning says - this should be favorable from the point of view of evolution, unless there is a some indispensable purpose served by this sound, which can not be otherwise served. This page seems to suggest that this is so from the point of view of mating. In fact, quoting verbatim:



Since female mosquitoes are larger, they flap their wings slower, and males know it. They use the distinctive pitch of the females' buzz to recognize them. Louis M. Roth, who studied yellow fever mosquitoes for the U.S. Army during World War II, noticed that males ignored females whenever the females were quietly resting, but whenever the females were flying, and therefore buzzing, the males wanted to mate with them. The males even wanted to mate with recordings of female mosquitoes or tuning forks that vibrated at the same pitch.



But mating signals could also be of other forms, like some chemicals secreted (I envisage something like pheremones). Why is making sound so important? Why can't this noise be either less intense, or lie outside the audio range for humans (their targets)?



Answer



Your question is really good, but in actuality, they do evolve towards muting themselves, actually, they have pretty much done "most of the work":



It is assumed that microscopic scales along veins and wind margin
play an important role as a silencer as downs on the flight feather of owl.

From this we can assume that the effectiveness of these scales are high, as they had plenty of time to evolve; thus the other factor they should alter to make them quieter is the frequency of their flapping $f$, which can be calculated from the following equation:


$$f=K m^{-1/6}$$


where $m$ is the mass of the animal and $K$ is the proportionality constant. The resulting number is around several hundred hertz (Remi.b observed a value around 440 Hz)


There are two options for them, either increasing the frequency up until our ear is incapable of hearing it which would be impossible as even the highest flapping frequency can hardly exceed 1000 Hz, which is nowhere near the required 20,000 Hz. By increasing their body mass they could decrease the frequency but the needed 15-20 Hz is pretty low compared to the actual several hundred, thus it would likely need a complete body structure change which is not something to happen in the near-future.


An another solution might be a different strategy in flying. Gliding attacks might pay off really well (that's why owls on the other hand can't be heard during flight), but even though there are some insects capable of such[1], it would need an immerse amount of time, not talking about the problems that might arise from the bumping into of our body.


I don't think that the mating signaling would be indispensable from an evolutionary perspective, but this statement of mine can't be proved.





These are the physical/biological difficulties of the problem, here is one from an evolutionary aspect: They are not likely to have experienced a strong selection against this feature, as most of the possible victims are incapable of doing much against a mosquito due to the absent of hands (and tails are seldom enough to stop them). The first possibly blood-sucking mosquito was found to be living 79 million years ago, while animals that might be able to "seal their fate" are much more recent, while not even having success most of the time.





Saturday, 30 July 2016

graduate school - Academic dismissal from PhD program. What next?



A couple semesters after beginning my PhD program (in the US), I was dismissed from the program because:




  1. My GPA was slightly below the program's minimum (after being on academic probation for one semester already).




  2. After months of work as an RA in a research group, at the end of the semester, my adviser informed me that he was not satisfied with my research and would not continue to fund me.




  3. After that, the department was not willing to hire me as a TA, because TA funding was seen as an "interim" measure, and having a new adviser was necessary to continue in the program.





  4. I couldn't find a new research adviser because everybody would freak out about my GPA.




However, I have done very well on exams, and I had a great GRE score. What are my options now? Applying again? What could I say about my messed up situation in applications? What if I applied to another school?



Answer



I agree with the points in J.R.'s answer. I'd like to specifically address your question: "What if I re-apply to another school and hide my records in this school?"


This is a very bad idea. As pointed out in J.R.'s comment, most departments will require as part of your application that you list all schools you have attended, and send your transcripts. It would be unethical to omit your current program, and judging from your comments on J.R.'s answer about copied homework, ethical behavior is very important to you (which I commend). And on a purely practical level, it's extremely risky; if you get caught, it may very well end your career in physics and academia.


It is true that in the US, federal privacy laws prohibit your current institution (let's call it University X) from releasing your education records without your permission. However, these rules do not apply to so-called "directory information", which include your name and dates of attendance. If University Y calls up University X and asks if you have ever attended there, X will tell them. They won't tell them how you did while you were there or why you left, but Y will know that you falsified your application. So if anyone at Y ever suspects that you attended X, they can verify it.



If you don't mention X in your application, Y may not think to do this. But if they eventually find out (and they probably will, see below), you'll be kicked out of the program and the years you spent at Y will have been wasted. If you received a fellowship or tuition waiver, you could potentially be required to pay it back. If you make it to graduation but they find out later, your degree could be revoked; this will probably get you fired from whatever job you hold by then. Basically, once this becomes known, your professional career will be over. It's a Sword of Damocles.


And it's going to be very hard to ensure that nobody at Y ever finds out you were at X. Interview questions: "So what were you doing for the two years after your bachelor's?" You'll have to never mention your time there or anyone you knew at X in any conversation with advisors, professors, or fellow students. And the academic world is small: there's a very good chance that your advisor or someone else at Y knows someone at X, and your name could easily come up in casual conversation. "Hey, I saw your new paper with your student user10165; I guess he's come a long way since his time with us at X."


Summary: Don't do this.


pharmacology - Is half-a-tablet of X a substitute for a tablet of X/2?


This may be anecdotal.


At the pharmacy earlier, the prescription called for a drug with X mg of the target chemical. The pharmacy however only had stock of a higher potency of the same brand.


E.g. A prescription may call for 25mg of a particular chemical, whereas the pharmacy could only service a request for 50mg of that chemical in the same brand.


According to the pharmacist, and the medic - a proportional fraction of higher potency drug of the same brand may be substituted for the lower potency. Thus in the example above, half-a-tablet of 50mg may serve in lieu of a single tablet of 25mg.


For a given brand




  • Is half-a-tablet of X a substitute for a full tablet of X/2?

  • Does the corollary scale upwards too?



Answer



Disclaimer: all of this is not to be considered medical advice but rather a general explanation. You should talk with your physician and/or pharmacist on a case by case basis when determining whether to take a drug and how to dose it.




We should consider that most pharmaceutical forms are made up from two main components: the active ingredient(s) and the excipients.


The active pharmaceutical ingredient is:




the substance in a pharmaceutical drug or a pesticide that is biologically active.



That is, the part of the drug that actually "does the job". Note that the dosage on the package refer to this, not the weight of the pill! For instance 500mg aspirin will contain 500mg of the active principle (acetylsalicylic acid) but the pill itself will weight more than 500mg.


An excipient is:



an inactive substance formulated alongside the active ingredient ("API") of a medication, for the purpose of bulking-up formulations that contain potent active ingredients (thus often referred to as "bulking agents," "fillers," or "diluents").



This does not normally have biological effects, but allows you, for instance, to have a pill that is of sufficient size to be easy to take in your hand.


When you split a pill in half you are assuming that each half contains the same amount of active ingredient.


This is regulated by the Pharmacopoeia*. In particular when looking at the monograph for tablets we can read (bold is mine):




Tablets are solid dosage forms usually obtained by single or multiple compression of powders or granules. In certain cases tablets may be obtained by moulding or extrusion techniques. They are uncoated or coated.


Tablets are normally right circular solid cylinders, the end surfaces of which are flat or convex and the edges of which may be bevelled. They may have lines or break-marks (scoring), symbols or other markings.


If the break-mark(s) is/are intended to facilitate breaking the tablet for ease of swallowing a dose consisting of one or more whole tablets, the scoring is not critical. However, if the break-mark(s) is/are intended to permit accurate subdivision of the tablet in order to provide doses of less than one tablet, the scoring is critical. Tablets containing active ingredients having a narrow therapeutic window should generally not be presented with break-marks for subdivision. Non-functional break-marks should be avoided.



The point about the therapeutic window shows why splitting pills may be dangerous. The therapeutic window is the range of concentration of a drug which treats disease whilst staying within the safety range.


If this window is narrow, minimal changes in the dose can cause the treatment to be ineffective -if there is too few of the active ingredient- or toxic -if there is too much.


The Pharmacopoeia also lists several tests to be done on tablets. In particular, in the presence of break-marks, the manufacturer should



ensure the effectiveness of break-marks with respect to the uniformity of mass or content, as appropriate, of the subdivided parts so that the patient receives the intended dose.



A suitable test to assess the uniformity of mass during development is as follows:


Take 30 tablets at random. Break each tablet by hand and take one part for the test and reject the other part(s). Weigh each of the 30 parts thus obtained and calculate the average mass. No individual mass is outside the limits of 75% to 125% and not more than one individual mass is outside the limits of 85% to 115% of the average mass.



I will not go into further details, but there are, for instance, other tests to be done to ensure uniformity of mass and content from tablet to tablet, as well as their physical stability (i.e.: they don't have to fall apart in the box).


Note that the packaging should generally include instructions about whether it is safe to split the tablet and how to store (and how long) unused pieces.


This is for splitting tablets. The opposite situation may also arise. Are 2x2mg tablets equivalent to 1x4mg one (speaking of weigth of the active compound in the tablet, not the weight of the tablet itself)? The same reasonings as above apply, however, because tablets should be uniform and no breaking is involved, this is generally safer than the previous case.


All of this applied to a single dose of a drug. Now I would just add a word about repeated doses. I cannot stress this enough: always refer to your physician about drug dosing. Taking a pill in the morning and one in the evening is NOT the same thing as taking two in the morning and none in the evening or taking four halves during the day. Self-dosing is dangerous and should never be done.


Taking half the dose may result in sub-optimal concentration of the drug (so it won't work as expected). Taking twice the dose may result in a toxic peak concentration, which is obviously not something that you want.




* note that there are multiple Pharmacopoeias, and the exact directives may vary. For simplicity I will refer to the International Pharmacopoeia, 4th Edition, 3rd supplement, published by the World Health Organization, and available online. There are others, such as the European Pharmacopoeia (apparently not freely available?) or the Japanese Pharmacopoeia, but I guess that goes beyond the scope of this answer.



graduate school - How to efficiently read mathematically and theoretically dense books in STEM fields?


When it comes to reading, there are literally thousands of methods from Speed Reading to SQ3R to Sequential(Word by Word till the end). My question is regarding reading mathematically/theoretically dense books as a graduate student. My question is primarily targeted to Science, Technology, Engineering, and Math (STEM) fields.


I have read the other question on SE and this is designed to act as a question on similar lines but for books (> 400 pages) typically found on Reading Lists for Quals. I believe how one reads a book differs significantly from how one reads a paper. (This could be a question as well but IMO, the length, intention and structure are sufficient to cause the difference)


In order to make this an objective question rather than a vague and open ended one, I wish to concentrate on the following:





  1. Should a book be read from start to finish word by word or through iterations (Skim, Analyse, Summarize)?




  2. If I am interested in a particular chapter with a lot of dependencies, is it in my interest to read everything till that chapter or read that chapter > google unknown terms > read chapter again and loop?




  3. If one gets stuck for over a certain threshold at something is it wise to continue assuming it as true or to persevere till the end and figure it out. This is true for research papers, is it true for books?




  4. How much time per (mathematically dense) page is ideal? This will vary a lot with field but not so much with person as it would with fiction (IMO).






Answer



I have never (as far as I can remember) read a technical book cover to cover from start to end. Most of the time, I have a problem in mind that I want to solve, and I'm looking for tools to solve it; more often than not, if I'm trying to learn out of a book, I'm actually reading three or four books at once. I dive into the middle of a book that seems most relevant; if I don't understand something, I'll back up, and if I don't understand that, I'll back up again, and if I get really stuck I'll put the first book down and pick up a more elementary book, and so on until I'm on firm ground again. ("Getting really stuck" only happens after relying to work through/reconstruct details on my own, in addition to trying to understand them from the book's presentation. I have taken months to read through one page, always feeling just close enough to understanding that I never felt "really stuck".) Whenever possible I pop back up the reading stack with my target problem in mind, skipping entire chapters if they don't seem relevant (but backtracking if I discover later than I'm wrong), working forward again until I either find the tool that I'm looking for, conclude that I've been on a wild goose chase, or give up on the book.


Yes, I miss a lot this way. Yes, I get a lot of weird ideas that I later have to kill off. But I just don't have the patience to read large volumes of technical material that doesn't seem at least remotely relevant to some problem at hand, and prioritizing often leads me fairly quickly to tools that work.


Your mileage may vary. Caveat lector.


Friday, 29 July 2016

authorship - If I work on a project but don't do research, should I be included as an author on a paper?


This semester I started working with a professor and a PhD student on one of their major projects, which is an application of their research. Though I was not involved with the research that went into developing the "idea" for the project, I have spent a significant amount of my time helping them to actually build the project, and a lot more work is planned.


Would it be typical for someone in my position to be included as a co-author on the paper that motivated the project I'm working on? Again, I wouldn't say that I have done any research myself, but I have done significant work in getting this project built, and the project is the main product / showcase of the research they performed.


Assuming it's reasonable for me to be included on the paper, how should I go about bringing that up?



Answer



Taking your statements at face value (and thus imagining something like the others having designed X and evaluated X in a study, while you implemented X based upon their designs), this sounds like a typical situation where you should be mentioned for having conducted the implementation/practical construction. This should certainly happen in a presentation of the work, and possibly (if the paper has an Acknowledgments section and if space allows for it) also in the written text.


Admittedly, this is at the verge participating in the design / idea of the research at hand (and maybe you even did contribute some detail decisions without realizing), so including you as an author depends a bit on the concrete circumstances - and also on the main authors' personal preference (but then, so might accusations of gift authorship in this case).


As for how to bring this up with the authors, you could ask in a somewhat unspecific way such as "I'm interested in gradually increasing my level of participation in research papers, is there a chance for increasing my contributions and acting as a co-author in the future?" That way, chances are the main authors will immediately get the idea of adding you one way or another in the current paper, while at the same time, you are not burning any bridges by appearing too demanding.



What do I need to include in a tenure-track assistant professor job application cover letter?


I am currently applying for tenure-track assistant professor jobs. One of the positions requires me to submit a cover letter, in addition to a CV, research statement, and teaching statement. (The application is online) I am thinking of writing the following:



October 1, 2014



Dear faculty committee


I wish to apply for the faculty position in the Department of Mathematics at Stanford University. Currently, I am a postdoctoral fellow at the University of California at Berkeley in the Department of Mathematics under the supervision of Dr. James Moriarty.


Enclosed are my curriculum vitae, teaching and research statements, and two research papers. Please do not hesitate to contact me if further information is needed.


Yours truly,
John Watson
Department of Mathematics
University of California at Berkeley
123 4th Street, Box 5678
Berkeley, CA 12345-6789
(123) 456-7890





  • What is the purpose of the cover letter? Is it just to indicate what are the documents included in the application? I ask this because most of the other positions for which I am applying don't require a cover letter.

  • Should I include a brief summary of my research interests and teaching experience, one paragraph each, in the cover letter?


Edit: In reality, I am not in the field of mathematics, nor am I a postdoctoral fellow at Berkeley. The details in my cover letter are fictitious and meant only to illustrate the structure of the cover letter which I will write.



Answer



I'm a mathematician, and I was at Berkeley. I wrote a cover letter similar to yours and got exactly one interview that year (it was 2010, but still). The only reason I got that interview was because a member of the committee thought very highly of one of my letter writers.


I would suggest you write brief paragraphs regarding teaching and research, and order these paragraphs depending on how you gauge the focus of the department.


I would take this as a basic template for the cover letter you are going to write. As you get ready to apply to a school, you should try to learn as much as you can about the department. Is there someone there you would like to collaborate with? Do they offer any courses you would really like to teach? Do they offer an REU that you could contribute to? You might also morph your research paragraph into a "student research" paragraph if that is what they are looking for.



Many of these departments won't look at the letter at all, but you don't know which. For the ones that do value it, you want to show them that you understand what they are doing and want to be a part of it.


coursework - A lecturer is hard to understand, what to do?


I have a lecturer at university that I find very hard to understand. My lectures are taught in English, but my lecturer is of East Asian origin, and English is not his first language.


I find the lectures incredibly hard to follow, just trying to understand what is being said requires a substantial effort, and I find the material is challenging in any case.


There is no textbook for the course, but we are given printouts of the lecture slides that are used in the lectures (six to each side of an A4 page). While the lecture slides do contain the material, they don't explain it like a good lecturer would.


I've spoken to my tutor about the course, telling him that I find it very hard to follow the lecturers. Many of my peers feel a similar way to how I do.


Finally, let me point out that I bear the lecturer no ill will; I just want to do well on the course.




Thursday, 28 July 2016

neuroscience - Optogenetics - How do microbial opsins work?


I'm just introduced to the optogenetics method and am having some trouble grasping the genetics (of the optogenteics) part of things.


So we have Retinal and Opsin that form Rhodopsin molecule that serves as a light-gated ion channel (which is, needless to say, very cool).


What is the process in which a cell population is targeted and implanted with these Rhodopsins?


And where does the microbial opsin gets into picture?


My main resource, so far, was - Optogenetics - Method of the year/Nature.


Thanks!



Answer




There is nothing special about the use of rhodopsin when compared to making a cell express any transgene. This question can then be read as:



What is the process in which a cell population is targeted and implanted with a gene of interest?



There are many ways, which depend on the specific cell type and on whether you want to do it in vitro, in vivo and in which species, and it would be very complex to explain them all in detail here, so I will limit myself to two approaches that are popular when doing optogenetics in rodents: viral infection and transgenesis.


Viral infection uses an inactivated virus to deliver the transgene. Essentially you engineer a piece of DNA with the gene for the bacterial opsin of interest and you put it in a viral envelope, that is a series of proteins that form the "body" of the virus and that contain its genetic material.
You then inject the virus in the desired zone (e.g. in a specific brain nucleus) and wait for it to infect the cells around the injection site. A week later those cells will express the transgene.


For (at least, I think) historical reasons the first type of viruses used for this approach were lentiviruses. These, however, are a tad more complex to handle (especially as they require specialised rooms where they can be handled safely) so adeno-associated viruses (AAV) are becoming more and more popular.


Note that the virus is inactivated, that is, it cannot replicate, just infect the cells around the infection site, but it will not be able to spread around. This is both for safety reasons and because you want the infection to be confined to the specific region where you injected the virus.


As I was saying before, instead of putting a bacterial opsin you can put whatever gene of interest, the procedure is the same. As for the opsins, the first two that were used were the channelrhodopsin-2 (ChR2), a channel sensitive to blue light and that can be used to depolarize (=excite) the cells and the halorhodopsin (NpHR), a chloride pump sensitive to yellow light that will, conversely, hyperpolarize (=inhibit) the cells.

There are nowadays tens of variants of these and other opsins that can be used to drive cell activity with lights. Many of these are described in this (beware! Quite technical) review:


Optogenetics in neural systems - Yizhar et al., Neuron 2011


Transgenesis works instead by generating an animal that carries the opsin (or any other gene) in its DNA. This can be done in various way, such as by microinjection of embryonic stem cells carrying the transgene.


You can find a fairly detailed explanation of the process here: Transgenic Cells and Gene Knock-outs, well summed up by this figure (taken by the same page):


Transgenic mice generation http://9e.devbio.com/images/ch02/wt020302-2.jpg


But how do you get cell-type selectivity?
In front of the gene for the opsin you also will have to put another sequence, called promoter. The promoter is a sequence that is specific to each gene and that is used to determine which genes a cell will or will not transcribe. For instance, the promoter for the gene coding for a protein only present in muscles will be used by muscle cells but not by neurons. You can even get more specific, for instance by using promoters that are typical of a subset of cells and not other (e.g. glutamatergic neurons use a different set of promoters than GABAergic neurons, although these two sets will -at least in part- overlap). However, this means that if you want to change the cell type you are working on you will have to change the DNA vector you are using.
A commonly used approach to avoid this is that of using Cre-dependent vectors (note that this can be used both for viral infections or for transgenic animals).
Essentially you will have a mouse line which expresses a protein derived from the P1 phage, called Cre recombinase, only in the cell type of interest (again, using a specific promoter). Cre has the property of cutting DNA next to specific 34 base-pair-long sequences called loxP (with sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT). Essentially, if you have loxP-[some sequence in the middle]-loxP and Cre recombinase is around, it will cut away the sequence in the middle, leaving only a loxP sequence.
Hundreds of different Cre-expressing mouse lines are commercially available nowadays, to target many different cell types in different organs.



Now, you just need a construct that allows you to express the opsin in a Cre-dependent manner. This is what was done by the group of Hongkui Zeng, and reported in this paper:
A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. - Madisen et al., Nat. Neurosci. 2012


Without going into too much details, the idea is to flank a STOP sequence with two loxP sites. This will block transcription (that is what a STOP sequence does) unless Cre-recombinase is present.


Essentially:


Cre-dependent expression of opsins
Source: myself, CC-by-sa licensed, feel free to reuse it


Note that in the scheme, ROSA26 is an ubiquitous promoter, that is, a promoter used by all cells, so in this case the specificity is given by expression of Cre recombinase and not by the promoter of this construct. Also, a fluorescent reporter (e.g. GFP) is inserted to be able to visualize where the opsin is expressed.


By breeding these mice with the Cre-line(s) of your choice you can then express the opsins in the cell type of your interest.


dna sequencing - What direction is a sequence in databases written?


In many databases, the DNA sequences for proteins are given as a string of a,t,g,c without specifying whether the starting is from 5' or from 3'. Also it is not specified if it is the coding or non coding strand.


Is it because all the sequences are written from 5' to 3' of coding strand only?



Answer



Directionality


It is indeed the convention to represent nucleic acid sequences in the 5ʹ to 3ʹ direction.



This is implied in the IUPAC/IUB document on Abbreviations and Symbols for Nucleic Acids, Polynucleotides and their Constituents, although not stated explicitly — presumably because this was written in 1974, before the large nucleic acid databases were established.


Strand


In general you can assume nothing about which strand a particular feature is located on. You need to refer to the context or documentation for the particular database that you are using.


I prefer the term ‘sense strand’ to ‘coding strand’ as explained in another post. However this only has meaning in a restricted set of circumstances relating to mRNA, particularly considering cDNA copies of eukaryotic mRNAs. Only if the context indicates that this is the case can you assume the strand presented as a ‘sense strand’.


The problem arises from the fact that for all (or almost all) genomes, different genes are located on different strands of the DNA — the chromosome has no unique ‘sense strand’ or ‘coding strand’. Thus, for DNA sequences in a database such as Genbank, the following are possible:



  • The DNA sequence presented does not encode protein or structural RNA.

  • The DNA sequence presented contains genes on both strands.


An example of the latter is given in the Sample GenBank Record which should be consulted to understand the feature annotation in DNA sequence entries in GenBank. This 5028 bp yeast chromosome entry encodes two genes. The first, AXL2, is annotated:




 gene            687..3158
/gene="AXL2"

The second, REV7, is annotated:



 gene            complement(3300..4037)
/gene="REV7"

This indicates that, when presented in the 5ʹ to 3ʹ direction, the gene REV7 lies on the complement of the strand presented.



publications - How do editors assess urgency of submissions?


How do editors assess urgency of submissions? Speaking about the same journal.


Urgency's context is 'your paper is not of sufficient urgency for our journal'.


Do they have specific (confidential) guidelines which they distribute among themselves?




reputation - Be a member of TPC of a low quality conference


Recently I have recieved few emails from conference organisers to become a member of conference technical program committee. Three of them are international conferences and going to held in China and Thailand.
I am a fresh PhD is it good to participate in low quality conferences as TPC member?
it will have a positive or negative impact in my resume?




plagiarism - How to handle someone propositioning me to collude/cheat with them on an assignment?



I am doing my final year of undergraduate. Mostly I am working on my Honours project but I have a few units from earlier years that I am still doing as I did some out of order.


Another student, call him John, sent me a message on Facebook (via the message people who are not your friends feature.), saying basically:



"Can you send me the solutions to the Assignment from unit X, that you took last year. In exchange, I will tell you what the future minitest questions are for unit Y that we are both doing this year."



Attempted Collusion is not explicitly mentioned in the Universities Academic misconduct guide.


Unit Y has weekly minitests, that are worth in total something like 15% of our final grade. The minitests happen during tutorials. There are 3 tutorials each week, on different days, with roughly a third of the class in each. Each minitest is the same, across all streams. They are mostly a way to check up and see that you understand the content.


They have at the top of each page:



IT IS NOT PERMITTED TO TAKE THIS PAPER AWAY FROM THE TUTORIAL SESSION OR TO DIVULGE ITS CONTENT






John is in the first tutorial of the week. So he would find out the questions first, then could tell me them so I could study for them, for when my tutorial is.


What he apparently doesn't realize is that I too am in the first tutorial group (with him).


I guess Unit X is using the same assignment as last year. Or a similar one. Or that John thinks it is.


A complicating factor is that I really dislike John. He doesn't seem to have realised this. I find him personally annoying, and consider him a poor student. I don't understand how he has managed to pass enough units to have not been suspended for poor performance. It may be he is very good at exams, or it may be that he has been cheating all along.


I have a number of options, and could do one or more of them:



  • Ignore it, and block him on Facebook.

  • Tell him no, and refer him to the universities plagiarism/cheating policy


  • Speak to the Professor of Unit Y about it (that we are both studying).

  • Speak to the Professor of Unit X about it.

  • Speak to the Head of School (sub-department), who is above both units

  • Speak to the University Dean. Who is in charge of enforcing the Academic Misconduct policy. (Will probably mean going though channels)


In my case, by coincidence, Unit X is being taught by the Head of School (who I have never studied under). But in the General Case both options exist, and I can approach him, either as the Head of School or as the Professor of the unit, I guess.


I think that ignoring is probably a bad option, if someone sees that I have been asked about this, and left it without response, they might think this is normal behaviour for me.


If I go to faculty, he may be suspended. I worry that I am a bit too willing for that possibility as I don't like him. On the other hand it isn't my job to decide the consequences of his actions.




Update: I have spoken to the coordinator of Unit Y. Who said if I wanted he would take it to the Dean but that it would involve me having to do stuff. He also said to contact the coordinator of Unit X (who happens to he head of school). He is out of the country for a week so I sent him an email (CCed to the coordinator of Unit Y). I also responded to John, saying No, and referring him to the Academic Misconduct policy.



Update2: I got a response from the Coordinator of Unit X, saying he would look into it. Unit X coordinator is on long-service leave (Not sure how that is going with him still coordinating the unit. He may be doing only light administrative tasks. Or it may be he forwarded it to the new coordinator).



Answer



Putting such a request in a written, verifiable manner as this student has done is incredibly dumb, and frankly merits whatever punishment is associated with this.


Although in principle you could simply ignore the request, I think this is one of those cases where you're better off reporting it. Otherwise, there's still the possibility that "John" could bring you down with him (he wrote you a note, after all!). So I would write to him declining the offer, and then report it.


copyright - How can I "time-stamp" my data without publishing it?


If I have a DB or set of data, and want to grant access to it to a limited group of experts in a field (not general access), and don't want others using it for their own publications, nor seeing the information being offered for free on the Internet.


What is the best approach to deposit the information somewhere to make sure, in a hypothetical future, that I can claim copyright over it?


Basically, I want to protect myself upfront against My research work stolen and published as his own by the co-author without my consent




ethics - Meeting dishonest ex-supervisors at large international conference -- Should one speak out?



I have returned to my country after one negative experience as a postdoc in China. In short, I was hired based on false salary & funding expectations supported by shady vague contracts written in Chinese. I stayed until the end as to escape a raging crisis at home.


Now I am back home, among long-date colleagues & collaborators. A large international conference in our field of study starts today. The very same PIs who lured me into their trap are coming, now in my country, actively seeking for new candidates. Surely they expect me to treat them politely, coldly at best. These people owe me a lot of money, plus stolen time and project ideas.


I think they expect me to stay nice and quiet for fear of getting bad recommendations and in the hopes of perhaps getting paid/compensated in the future. The culture here is certainly different from what they expect. In just few hours I will meet them at the conference hall, for the opening.


I am revolted. At least in my country, LoRs are not required for getting jobs, and I do not think they're too influential outside of their institutions.


Should I openly expose them? Or would that just label me as some begrudged nuthead?


There is one special roundtable about work ethics included, and I am thinking of approaching the organisation about this. Any suggestions, ideas on this, would be appreciated.


P.S. This is not in the US.


UPDATE:


Finally the event is coming to an end. I have carefully considered the views of commenters and answers here. Thanks to all for so much attention.


I have avoided the scammers as best as I could. They approached me individually, on different casual occasions, to greet and initiate some chat. I was just plain cold, cutting it short. Fortunately they got the message and have been also avoiding eye contact and interaction. I have outlined the absurd situation to a large number of peers, yet only when asked. “How was it in China”, “I remember you complaining about some problems, how did that fare” etc. I did not mention names, except when directly asked for confirmation. A couple of friends are part of fhe organizing comitee. They agree in that it’s best to only bring this up to the chairman in case these scammers are openly advertising positions with false information. I did contact some local reporters I know who asked for an outline. Yet once they had the story they didn’t reply. I don’t think then this will hit the newspapers unless something new and remarkable happens.



The event ends tomorrow. They might approach me one last time. If they do I’ll comment below. Otherwise I’m leaving this at this. I’ve focused on intensively networking and getting collaborations moving, learning new ideas. Much easier without having to interact with this mess. Hopefully I’ve warned enough people to at least avoid someone else fall in this trap. Hopefully they’ll move to a different field or just stop. Thanks to all here.



Answer



If I might propose an alternative?


Your goal here isn't necessarily to accuse the supervisors in question, but to warn potential vulnerable victims to their scam. I don't work in academia, but I do sometimes have to cover the topic of government corruption, and avoiding slander can sometimes be simply the case of not accusing anybody directly.


So instead of saying these X people did Y terrible thing to me, consider:


I experienced Y terrible thing that has A, B, C traits (EG Chinese document that contains a dodgy contract, being paid less than stated amount).


So in your case, what you're doing is giving the people sufficient information to identify the scam/trap themselves (without saying who is responsible. If anyone asks, you can simply decline to name). Anyone reading between the lines will see what X person(s) are doing fits A, B, C traits and put two and two together. If X person(s) accuse you of accusing them, you can simply point out you never even mentioned them by name.


For them to argue it's slander, they would have to prove that their actions matches the ABC traits, which would mean they would effectively be proving it is a scam.


For handling them directly, I would propose you alert the appropriate legal/goverment/police department that handles fraud (potentially as an anonymous tip-off, but more useful if you were a named source), because if they induced you into accepting a contract via deception, what they are committing in most countries is effectively a crime, and it's likely you're not the only person they've scammed, and they appear to be, as you say, hunting for more.


It's worth adding: If they've left you out of pocket, you might even be able to get a no-win-no-fee lawyer to chase the costs back. Especially if you still have all the documentation to prove what you got wasn't what they induced you to believe.



Summary:


Your goal here is to use what you've learned in order to alert people to the signs of a possible scam so they don't fall for the trap. It might not just be the people you've met that are engaged in such practices, so it's probably an excellent idea to make it a warning in general.


Any matters of dubious legal practices should be handled legally and not in the public arena.


Wednesday, 27 July 2016

mathematics - How can one's career as a reviewer be ended?


In this forum, I am reading this great question (What is required of a mathematics referee?) by a user with the name mathprofessor. There is an answer by a user with the name Buffy which starts with:



Sorry, but if that's all you do, then your reviewing career is likely to be short, ending the first time you approve a paper that is revealed to have an error.



I am wondering now: How exactly can somebody's career as a reviewer end after some paper they reviewed is revealed to have an error?


Sure, the editor who assigned the reviewer may not assign them ever again, but how exactly are other editors (maybe from different journals) notified not to take them as a reviewer ever again? Is there some way the editor who knows is allowed to reveal the reviewer's identity? Or some higher authority they can talk to? Or how does that work out in practice?



Let us assume the following: If the answer is field-specific, let us assume we are talking about math. Moreover, as in the other question, let us assume there is no fraud going on -- the author made a honest (but big) error in the paper, and the referee was too sloppy in their report and did not note the error.


Additional question: Are there known cases where reviewers had to end their reviewing career because they did not notice an error? Again, I am assuming no fraud is going on.


Edit: I want to say that the user with name Buffy edited the answer in question and made a much weaker claim. This solves my confusion. Thank you very much, Buffy!



Answer



Well, not feeling obliged to review other people's papers anymore sounds like a nice deal so if you figure out an answer tell me.


Unfortunately, there won't be one. Not only do I know plenty of mathematicians who have approved papers with errors in them but I've known a number of mathematicians who were well-respected in the community despite the fact that everyone figured there was something like a 1 in 8 chance that the main claim of any paper of theirs would turn out to be fatally wrong. I can't say for certain that I've done it since obviously I would have flagged the error if I'd seen it and errors are so common that no one even mails the author for non-critical errors and a reviewer likely won't even be told if a fatal flaw in the proof is later found.


Hell, I've been halfway through extending people's published work only to email the author a question and find out that the proof is in shambles and they are struggling to find a patch. So it's literally the exact opposite situation where the total absence of errors is what would be unusual.


Indeed, I don't know anyone who has reviewed more than one or two math papers who hasn't approved a paper with an error. Studies suggest that something like 80% of published math papers contain some form of error (that's not a fatal error but still). Sorry if I don't remember the source on that study but I'm sure if you google it you can find the relevant info.




Note that I think this is a compelling reason that mathematicians should completely abandon the blind peer review process in favor of something like a math social network with up and down votes. Yes, still have two independent individuals read the paper and submit comments and demands for clarification but don't throw out all that the reviewers have learned by collapsing the judgement down to accept/reject. The mathematician I was thinking of with the frequent errors still did good work but often pursued proofs that were particularly knotty and difficult to check. The reviewers were well aware that certain parts of these proofs raised yellow flags but they couldn't specifically show there were any flaws and, since tenured professors aren't always willing to break things down to a tedious level or formality, I agree publication was the right call. However, a math social network could have passed along the reviewer's sentiment that they still have some reservations about the argument in part X moreover, the initial review will matter less since the accumulation of comments and the ability to use all professional mathematical readers of the paper as a crowdsourced continuing review will do more to help us build a mathematical edifice we are sure is true.



How do you write a letter of recommendation for someone who got an A in your class, but who you've never talked to outside of class?


I taught a large class last summer, and one of my students asked me to write a letter of recommendation. I said yes, and at this point I think it is too late in the application process to change my mind.


The student got an A in the class, but never came to my office hours or talked to me at all before she asked me for a letter of recommendation. She also hasn't done anything specific to distinguish herself. At this point I'm really not sure what to write about her, although she did give me a "brag sheet" with information about her interests and previous projects.


How should I go about writing the letter?




conference - Two abstracts accepted for oral and poster presentation, but I prefer they are swapped


A conference has accepted my two abstracts in the same track, the first for an oral presentation and the second as a poster.


However, I expected the second one would be accepted for oral presentation, as I believe it is more important and relevant to the area and probably to the track and the conference in general. It is also about my primary work, which is more sophisticated and robust than the first one, and I think it would be better for me to present it orally.



But I understand the conference committee have their evaluation and criteria for deciding the way of presentation for each abstract.


Shall I just accept this allocation, which is good anyway? Or is it common and accepted to request, with justification, that they swap the two abstracts - provided they didn't print and disseminate the program yet?



Answer



It does not hurt to ask. You can send a polite email explaining your reasons and ask if it is still possible to swap the talk with the poster. It is possible that the decision of the conference committee was based only on the number of slots available, and they will not hesitate to swap talks at all. It may be also that their decision, as you described, is based on some evaluation of strengths of the abstract and potential interest to it among the participants. In this case they will simply refuse to do as you ask, but you lose nothing but a bit of time.


The request to swap talks is not quite common, I guess, but also not unaccepted or weird. I would say, it is worth to try.


publications - What is the point in publishing a paper in a journal rather than arXiv?



I'm undergraduate student in Physics, I wonder what is the point in publishing a paper in a journal rather than arXiv ?


As far as I know, there is a fee which must be paid for publishing in a journal (It may not be valid for all journal or fields, I guess).I'm asking because If I do some publishable work on my undergrad research, what option would be more logical and advantageous ? How would they affect my future Phd admissions ?


Or if I ask my second question more generally, How would these options affect one's carrier in academia ?



Answer



Papers published in (reputable) journals are reviewed by other scientists (peer review), which usually makes it considerably more difficult to publish a paper there. By contrast papers on the ArXiv only receive a brief inspection to keep out utter crap. Thus, most academic evaluations consider only peer-reviewed publications or value them considerably higher.


Moreover, often only peer-reviewed papers are considered citable, in particular for purposes of backing up your claims. This may extend to papers that are considered certain to be eventually peer-reviewed¹, but this is unlikely to apply to your paper. As being cited (by peer-reviewed papers) is another important academic evaluation metric, this is another advantageous aspect of journal publications.


As a sidenote: There are a lot of physics journals where you can publish without a fee.




¹ in particular in fast-moving fields or fields with long peer review such as parts of mathematics


zoology - What is the anatomical term for a two jointed leg?


Allow me to apologize in advance for the layman's terminology.


I'm wondering what the anatomical term for a cat- or a goat-style hind leg is.


Cats, goats, t-rexes, and many many other animals don't have human hind legs (i.e., with one knee / one pivot point). They have two pivot points, with one bone going down, then another going back-ish, then another going down again.


I've googled and googled for the answer, but I'm completely at a loss as to what this is called! Is there any name for that style of leg? I'm sure there's a lot of variation inside the category, but there is a category, correct?



Answer



Welcome to Biology.SE!



I think you are talking about plantigrade, digitigrade and unguligrade.


Please note that the number of joints in mammals does NOT vary, but only the relative length (and shape) of the different parts of the leg.


enter image description here



  • A Plantigrade walks on the sole of the foot. 'Sole' translates to 'planta' in Latin hence the name.

    • Examples: Human, squirrel, raccoons, ...

    • Below is a chimpanzee skeleton





enter image description here



  • A Digitigrade walks on the digits (the toes).

    • Examples: dog, cat, hyena, ...

    • Below is a cat skeleton





enter image description here



  • An Unguligrade walks on the nails. 'nail' translates to 'ungula' in Latin hence the name.

    • Examples: cow, reindeer, goat, ...

    • Below is a cow skeleton




enter image description here



Tuesday, 26 July 2016

neuroscience - Glia/Neuron ratio


Research seems to indicate that the further we go up the evolutionary ladder, the higher is the glia/neuron ratio, to the point that in humans glial cells conforms 90% of the brain.


Now, if the glia/neuron ratio is somehow related cogntive capabilities (considering it is higher up in the evolutionary ladder), and since the ideal of a brain made solely of glial cells and no neurons seems absurd, how high can the ratio glia/neuron get before it starts to be detrimental?



Answer



TL;DR The glia-to-neuron ratio is not sufficient in order to distinguish humans from other primates or mammals.




The figures of the glia-to-neuron ratio (GNR) being 10:1 come from old studies that either used guesstimates for the number of cells in either category or used methods that have since been improved. The newest estimates range about a 1:1 ratio for the whole brain as reviewed in von Bartheld et al. 2016. These authors comment on the evolution of the GNR:




[Comparative studies have] shown that brain size does not scale universally with neuron number, that different mammalian species such as primates and rodents scale differently, that cell numbers in cerebral cortex and cerebellum evolve in a coordinated fashion, and that glia density and sizes vary much less than neuronal density and sizes. The GNR is highly conserved between structures and species, pointing to an important and close regulation of glia numbers (scaling) in response to, or regulated by, neuron density and neuron sizes.



At least in the cortex, cell numbers and size are kept to a minimum, as they take valuable space from what really matters, dendrites and axons (Chklovskii et al. 2004).


thesis - Is a copied acknowledgements section considered plagiarism?


A friend of mine has told me that his Master student (Chemistry) defended his thesis sometimes ago and everything went alright and he graduated. He recently realized that in the acknowledgements part the student has copied practically (word by word, line by line) the acknowledgements of another thesis available on the Internet by replacing the name of my colleague with the name of the supervisor of that thesis. He added that he was hurt by the fact that the student has not tried to say his 'thank you' words by his own words.


My first question is that can this be considered as a plagiarism?


My second question is that is it necessary to inform the student about this possible (if any) misconduct?




cell biology - Why are transmembrane proteins difficult to crystallise?


I know that in vivo there are a lot fewer transmembranous proteins in general, and that they are produced at a lower rate than their free counterparts. This is mainly because transmembrane proteins are only required in a 2D space on the membrane rather than a 3D cytoplasmic or extracellular space. This (again, very broadly speaking) means that the probability they will interact with their target is higher.


I also know that this is one of the reasons that producing crystals for X-ray crystallography is notoriously difficult for transmembrane proteins. What are the other reasons that make transmembrane proteins typically tough crystallisation candidates?


What specific part of the crystallisation process yields such poor success rates of transmembrane protein structure elucidation?



Answer



There are several factors that make obtaining crystal structures from membrane proteins more difficult. In brief, nearly every stage of obtaining the structure via crystallography is more difficult.


First: protein expression. Large amounts of pure, well-folded protein are required and this is much more difficult to achieve than it is with a soluble protein. Since membrane proteins are bound within a membrane, the mechanisms to translate the peptide into the membrane and to fold the protein in the membrane are different. They may involved folding factors which are only available in a particular compartment of the cell (making bacteria impossible as a system of expression). In high amounts in the cell, their hydrophobicity might tend to result in clumps of unfolded protein instead of gobs of membrane-associated protein.


Next: Purifying the protein is more difficult. The expressing cells are usually broken open in the presence of detergent to get the proteins to float around as individual proteins in detergent micelles. The wrong detergents might break up the membrane protein and it may lose its fold - the concentration of detergent must be carefully managed and kept at optimal levels or the micelles might break up and the protein will be ruined.


Crystallizing the protein is quite a bit more difficult too. Membrane proteins in detergent micelles which may or may not be charged themselves look like oily blobs with hopefully a domain or two of folded proteins sticking out of them. Compared to a soluble protein with a nice ordered surface in every direction instead of a detergent micelle which might undergo a phase change at high concentration or by the addition of a salt or change in pH, membrane proteins take a task that might take thousands of trials and adds new dimensions to worry about.


The proteins are 2D-like, but the crystals still have to be 3D for crystallography to work usually. Protein crystals are small, but those derived from membrane proteins - which tend to organize into planes like the membranes they inhabit - are often thin, which can make them too delicate and small to get a good set of data even from synchrotron beams. As a result, the crystals are commonly too small or thin to use at first, requiring extensive optimization after the first crystal are found.



In a few cases some membrane proteins have been solved with 2D crystals using electron microscopy on crystalline arrays of porins and rhodopsins in membranes. That was a ton of work but they were the first membrane protein structures by years and years.


Not to make all this sound impossible - once you have crystals, they can usually be improved; there are good starting points to crystallization and purification with detergents. It's just that a process which can already take quite a bit of time (years) and can sometimes end in frustration takes even longer and is less certain with a membrane protein.


Monday, 25 July 2016

industry - Why is getting a PhD considered "financially irresponsible" by some people?



I've been reading this question, whose premise is that going directly into industry after (presumably) just a bachelor's will make you more money than doing a PhD and then going into industry. To my surprise, most people seemed to agree with the OP.


My thinking has always been that, yes, going into industry with just a bachelor's will make you some money in the short term, but it will also:


A) Land you in a relatively low level position to start.


B) You will eventually hit a ceiling past which you cannot rise.


My thinking has always been that with a PhD you will start in a relatively higher position, and you will not hit a ceiling, so in the long run you will make more money. Why is my reasoning wrong?




evolution - Why can't humans drink sea water?


Why can't humans drink sea water?


It would seem to be a huge evolutionary advantage for an animal to be able to drink sea water rather than have to rely on fresh water, and it's provably not impossible due to the existence of sea mammals that must filter the sea water somehow.


Could someone explain to me any likely reasons that this is the case?




Answer



For humans, our blood and other tissues have a salinity which is less than that of sea water. The osmolarity of blood is 275-299mOsm/L, while the osmolarity of seawater is ~1000 mOsm/L.


The major reason we need to drink and excrete (sweat, breath and urine) water is to rid the system of waste- i.e. water soluble chemicals or heat we do not need. The kidneys do a lot of this work and they need a reasonable osmotic potential to help them.


The osmotic potential is the tendency of molecules, for instance salts, to diffuse from one reservoir of liquid to another. The kidneys burn metabolic energy (food) to create a slightly higher concentration of waste chemicals into the bladder/urine. Other organs will fail or also work to maintain a local salt concentration (e.g. any nerve cell which depends on Na+/K+ concentrations to transmit their signals. But the kidneys are the gatekeepers of salinity in the body. They work hardest (and can get injured) when there is more salt in the water we drink. If you drink sea water you will quickly find your kidneys overworked and not really functioning.


That's why salt water will tend to make you thirsty (if you can drink any at all). Most people will gag when they drink even a little sea water, much less a glassful.


Sea mammals actually eat their fresh water. They rely on the fluid they get from fish to keep their salt balance. Its true that some animals like fish and molluscs etc have adapted other means of keeping their salt balance in check. Its just also true that its a lot of work to keep this ability and when animals move away from the oceans, they quickly lose that ability.


publications - My work was published before me. What should I do?


Some time ago I switched departments within the same institution. Before leaving I had an idea of a paper and started to work on it. I shared my thoughts on it with my then-coworkers and they praised it. So now, after I settled things in a new department, I continued to work on that paper and completed it. Before submitting anywhere, I decided to look for a new papers relevant to my work.


To my surprise, I have found a paper with my idea (implemented in a somewhat narrower sense) by several of my previous coworkers, with whom I have discussed it. Without my name on the paper of course. The paper was published a few month after I left, so they probably started to work on it immediately after I left.


Most (if not all) conversations were done verbally, so I don't have any proof that I am the original author, and I also don't know any authority that I can go to and explain the issue.


What bothers me is if I publish the paper now (even in a broadened version of it) it would look suspicious to an external observer, as if we (together with ex-coworkers) are trying to overuse and multiply a single result or even worse that I'm plagiarizing over their work. As we are in the same institution and had previously coauthored some works, nobody will believe similar papers are a coincidence or a an independent inventions. (And they would be right. It's not.) I think that in the worst case it can destroy my reputation and career, or maybe it's a non-issue and I'm worrying too much.


I can see several possible extensions and further research paths to the paper. But if I'll try to develop these ideas and publish an advanced version of the paper, there is no guarantee that they aren't doing the same. They could even had already submitted them somewhere. And if I submit my version, the reviewers may reject it because of its similarity to theirs. This again can be devastating to me.


What options I have, as I see it:




  1. Pretend I don't know about their work, and publish mine as fully original, without citing them. Even if it's still a more general view on the subject and I know I'm the original author, it doesn't seem ethical to me. And we're still in the same institution, what make things worse.

  2. Do more research, make more advanced paper and cite them accordingly. But they may even have submitted an advanced version somewhere. I can't be sure if I'm overlapping with them or not.

  3. Change the field of study completely to not overlap with them in the future. Seems to be an overreaction.

  4. Change the institution and then publish. Will it help? I'd still be their co-author-in-the-past. Seems not to be a solution at all.

  5. Mention them in the acknowledgements. Thank them for praising my work, and cite them through a footnote. After all, what acknowledgements are for if not to thank your colleagues? But I doubt any editor will let it pass.


TL;DR Several of my ex-coworkers rushed to publish my ideas as their own while I was working on these ideas. I worry that my future publications on the theme would overlap with theirs and be considered a plagiarism.


So what should I do? Am I right that my wrong actions could possibly damage my reputation and career?


UPD. Thank you for your answers, I see that I have to cite the paper by the old department researchers (still not sure how: through a regular citation or a footnote in the acknowledgements), but I'm not really convinced and just want to be sure that I would not get into any (more) trouble if I'll continue to do research on the topic (especially in the case when editor/reviewers will get similar papers from different people with the same affiliation). Maybe someone has had such an experience as a reviewer?




advisor - As a postdoc, how to deal with supervisor who keeps trying to involve my student in other projects?


I would appreciate very much an advice on the case which I will describe after a short intro about myself. Such introduction is not really necessary for the matter of question, but I hope it can better explain my situation.


I am PostDoc working in the field of one of the nature sciences in one of German Universities (I apologise for being so cryptic). It is my second postdoc position and I am doing science for about ten years. I moderately rate my achievements although I have several publications in high rank journals and currently my Hirsch index is 10.


Around three year ago I wrote a project for the German Research Foundation and was granted finances for one PhD student. Before submitting a project I discussed the matter with my prof. He was not against such project, but not very encouraging either.


After the project was granted I was first surprised that my boss used all possible kinds of arguments to prevent me of publicly advertising the position. After almost nine month of indeterminacy he suggested me to overtake one of our master students on this position. After all, it was not a bad decision because the student has already worked with me and we had a good experience of collaboration.


Currently, my biggest problem is that by boss interfere in all possible ways with our scientific work. He constantly tries to involve the student in other scientific projects. I would completely understand such approach if we were failing in some respect. On contrary, we regularly produce high rank papers, where my boss naturally is the last “courtesy author”. I spend sufficiently large time working with the student having 4-6 hours of weekly discussions.



One might say the situation is favourable to me. However, as scientist aiming at permanent position I am concerned with development of my own way in science, and working exactly according to the plan of the research project suits this aim. Therefore, I openly talked to my boss to get little bit more scientific independence. I was surprised to hear that "extra projects are in the interests of the student's scientific career". I am failing to see how this can be the case... (jumping from topic to topic?)


I need you advice how to deal with this kind of situation. Of course, I do not want to make strong steps because after working for so many years with my boss I heavily depend on him in e.g. searching for the next job.




Edits in response to comments




I am greatly surprised with the comments below which perceive everything from a very idealistic perspective:




  • Even though it might look selfish it is a post about my problem as a scientist trying to establish my way in science





  • I am also interested vey much in student being able to establish in science. Since the time for PhD is limited, in my view, involvement in too many problems, superficial approach is bad in a long time perspective




  • In the same way as time for PhD is limited same is true for Postdoc experience. Allowing the student to work on other projects also reduces the outcome of my project. In numerical terms it reduces the number of publications on the topic as I deny an opportunity to be a courtesy author. Which is never the case for my boss






Sunday, 24 July 2016

Map (tree) of citations/references



I was wondering if there already exists a software/service that allows to build a tree of references/citing articles starting from a selected paper X. For example paper X has a list of references, call it bibliography[X]. This list of references is usually presented in the journal's webpage and, in fortunate cases, the list is also accessible by cross-reference. The idea is then to go to all the papers Y in bibliography[X] and repeat the process for the papers in each bibliography[Y] up to some depth.


On the other hand, we could also look at the citing articles of X, which is also displayed in the journal's webpage as well as in other resources, e.g. Google Scholar.


In this way the tree of references/citing articles of X up to some depth can be obtained and plotted in a nice graphical framework and perhaps display relevant information of the vertices of the tree like title, doi, etc. In my opinion this would be a very nice and efficient way of discovering new papers related to some paper, e.g. a seminal paper (citing articles tree) or to look into the history of a subject (references tree).


I have been looking for something like that for some time but so far nothing. I think Microsoft Academic Search would have the potential to do this by using the same framework they use for the Co-author path. Also there is this project for JabRef but it is not what I'm looking for.


Edit: Something like this would be perfect but unfortunately it is not available to the public.




botany - How much oxygen does a plant use up at night?


Given the fact that plants cannot do photosynthesis at night but need respiration for their energy needs, they use up oxygen and generate carbon dioxide. But how much is this? If I fill a room with plants thoroughly, what composition will the air in this room be in the morning? Are different plant species vastly different in this regard?




zoology - Do cockroaches lay eggs in human flesh when they "bite"?


Recently, I discovered a "bite" by a cockroach, and not only is the "bitten" area red and swallowing, and more specifically, it have a big hole in that area, but when I clean it with hydrogen peroxide solution, something is happening, that is, a yellowish/greenish thing comes out from the holes from each infecting area.


Do cockroaches lay eggs in human flesh when they "bite", and much more importantly, would hydroxide solution kill the eggs and parasites inside those of those holes?



Answer




No, cockroaches do not lay eggs into human flesh. You most likely received an infection of some sort from the bug, or it wasn't a cockroach.


Saturday, 23 July 2016

What is the time and topic etiquette for a first meeting with a professor to discuss research?


I am meeting with a biology professor to discuss opportunities for an undergraduate research assistantship. I initiated the contact by introducing myself via email and sending him my CV and general areas of interest. He agreed to meet with me to discuss research opportunities, but I am wondering what is the expected length of a meeting like this? Also, are there any materials (e.g. printed copy of my CV) that I should bring? Should I come prepared with questions about his research (which would require hours and hours of critical reading, because while his work seems interesting to me, it's also very difficult to fully understand) or simply honestly tell him that I'm not as knowledgeable about his work as I would like to be but it sounds very interesting to me and I want to be involved? Lastly, is casual clothing appropriate?


Any answers are appreciated. Thank you.




graduate admissions - Getting into math ten years after a BA in English


I got a BA in English at a pretty good school, spent the next 10 years in a fruitless pursuit of screenwriting with a day job in a legal department, and now that I'm sick of all that, I'd like to do something mathy. And it seems pretty clear that that's going to require going back to school.


Since this is a HUGE redirection -- a ridiculous one, really -- I assume I should get a second BA/BS before even considering a masters, right? I did well in math in school, but I left off at single variable calc. (I'm currently studying linear algebra on my own and loving it.) But what, really, are my chances for even getting into a decent second bachelor's program?? I'm thinking of taking college extension classes to get more experience and recommendation letters for that purpose. If I get some online bachelors degree (EDIT: or a post-bac), are any (reputable) masters programs even going to consider me??


You may well ask what my eventual goal is, but I'm at such a basic level that I'm not sure that that question is all that relevant. If I were to pick a goal just for the sake of aiming for something, getting a job in statistics sounds interesting, but who knows what I'd want to do after getting a second bachelors. I'd like to try my hand at research, but that sounds way too pie-in-the-sky given my background.


Thanks for any advice or feedback.



Answer



You are not prepared for a Master's program right now, which I think you recognize. That said, it may not take too long to prepare yourself. I would recommend looking at requirements for continuing education and graduate programs at nearby regional universities. Many of them have programs designed to accommodate a student with your needs. For example, here are the requirements at CSU East Bay, a regional school near Oakland. Note in particular the Post-baccalaureate unclassified status. You might not expect it, but many such programs are quite strong and have a solid record in placing students in PhD programs. Don't discount them.


Does taking courses of various subjects matter in PhD admission?


I'm going to apply for PhD programs of biology or biomedical science. I understand that I need certain semesters of biology, chemistry, biochemistry, and mathematics. Because I'm going to graduate in four years while double-majoring in math and biology, I can't afford to take courses of various subjects, as I can take, except for subjects belonging to math and science, only one semester of social study and humanities, two semesters of foreign language, and four semesters of PE. Since my college has quasi-open curriculum, there's no problem with the credit requirement of my school.


But should I take courses of various subjects for my PhD admission? Does variety of courses taken in undergrad matter in PhD admission?




Answer



If you are attending universities outside of the US, you normally wouldn't have much in the way of diversity—almost all of your courses are directed toward the general area of your major. So it's not that big a deal not to have too many outside courses.


In general, though, I also think that admissions committees do not place as much weight on courses outside the major as courses in the major. If you are a physics major, for instance, a C in a US History course is not going to be as problematic as a C in electricity and magnetism.


Friday, 22 July 2016

How does DNA damage cause ageing in yeast?



As I understand it, in yeast ageing there is daughter cell and mother cell. The daughter cell is has newly "fresh" DNA and mother cell dies after some counts of replication.


What happens to the accumulated DNA damage in the yeast mother cell?


One of theory of human ageing is accumulation of damage in nuclear DNA. The daughter yeast cell is clone of mother, and has same DNA. What happens with this damage?


Edit to simplify: Why is the DNA damage not transferred at all to the daughter cell? The repair mechanism in humans is evidently not perfect, because DNA damage is one of major ageing theories. So if we die from this, how do yeast get around the detrimental affects of DNA damage that cause ageing in humans?




research process - Nonpaid, volunteering position in a lab


I already have a BSc degree from an unknown school in outside the US. I have convinced a professor at a top US school to let me join his lab to work on a project that he will propose and conduct experiments at his lab. In return for learning and having access to the lab and working on a project, I am supposed to help the lab with programming their machines. However, there is no pay, that is my title would be "Volunteer". Therefore, I have to work in part-time or night jobs while working there (I have work permit).


Is this common in US, that is to work in a lab without getting paid and working on a part-time job outside the lab to pay for living expenses?




Answer



Your description of being "allowed" to do research work in exchange for programming work sounds off to me. Learning and running experiments for a research project proposed by a supervisor is basically the job description of a research assistant. It's work in its own right that people are typically compensated for in some way, not a reward for doing other (programming) work.


The arrangement you describe is not common, and it might also violate U.S. labor law. Under U.S. law, it's illegal to let someone work for you for free unless they meet specific legal requirements to be considered a "volunteer" or "intern."


"Volunteers" according to U.S. labor law are individuals



who volunteer their time, freely and without anticipation of compensation for religious, charitable, civic, or humanitarian purposes to non-profit organizations.



Your intent is clearly not religious, charitable, civic, or humanitarian in nature, so you do not legally qualify as a volunteer.


And to be classified as an "intern" you must meet the requirement that




The employer that provides the training derives no immediate advantage from the activities of the intern; and on occasion its operations may actually be impeded.



(among other requirements). That is, the employer cannot expect to be dependent on your work for normal operations. I don't think you meet the requirements for an unpaid intern, though it's not possible to be 100% sure from your description.


The usual interpretation of the U.S. labor law is that an internship has to be part of a formal educational program (e.g., you are enrolled as a student and get credits for the internship, or write a report which you submit to your home institution) or a formal apprenticeship for it to be legally unpaid. In fact, if you search for unpaid internships in the U.S., you'll find that most listings say that only current students who can earn college credit are eligible. It doesn't say in your post that you are currently enrolled as a student somewhere.


This is not to say that there is no legal scenario in which a U.S. lab can allow you to participate in research there without paying you. (If the entire experience was supposed to be for your educational benefit - including the "help the lab with programming their machines" part - then my answer might be different.) But from your description, I don't think the scenario you describe is acceptable or normal.


I personally do not allow anybody to do work for my lab unless they are paid or doing a personal project (like a thesis) for which they earn academic credit. I've been told it would be legally problematic. For example: suppose I have an M.S. student working with me for academic credit. He graduates in May and has a job starting in September. I'm not allowed to let him keep working in the lab from May-September unless I can pay him (according to my university lawyers).


(Disclaimer: I am not a lawyer)


Thursday, 21 July 2016

citations - Citing work with a publication year in the future



I am citing this publication in my thesis using the author-date citation format. The article is fully accessible, however the Journal apparently placed it into an issue that will appear next year. Therefore, the citation information (BibTex) says that the year of publication is 2017. I find it a bit strange to cite future work.


When citing research articles to which year should the citation refer to? The year it appears in the Journal or the year it appeared (online)?



Answer



Most journals take as formal publication date the date it appears on their printed version. The online version is considered a pre-publication.


Thus, despite how weird it may look, it is ok to cite an article from the future (as long as it is accepted and in press or the online preview). Journals with only online presence would not have this issue or the time span might be smaller.


What is probably important is to provide the DOI of the article (if available) as this will make it easier for people to find its online version before and after it has been published on paper.


Edit: Just to add that the citation and its details is decided/provided by the journal and not by you.